%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 540 780] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream xZn;)Y $oX+f,r`lZq@I%g^)"M!ΰ曮f/˗/.ޜ3qr^M' .^IɌyot"#ʴ@N~?32@$84o\xn:ynq4 )m-YhcT))ЎizuL^Yv\cKԮ _ޕb7N.n㨏a8 ͜nṩ?)|&Yq c^YT}9} }$ϗ_G$nۿv`ޚNq噖\1-Y}UTyC~: ͑d*xŇ˻0>?00B\t Mߖ$T.x*H.>ۖ *{FЧ4_zd{ 0hI 6?K\uO+>!嚹*WhQ4ݫp/>ܾ Lw.WBh{bV?-1zvM.BH8ązG &^tկϤ!CmЉ_iްQOѨP@- fK-> Z@s#-~9p*c*I3)0-R цT? KI[F^6s8?=`߀"bqݢX~(}Xg.fTcd:H}a-r 7d4{k;?P^Y(y-!E\DI?"3ڿZF(QJ80z':|@)ԂQF?Rj\WJ"n/:&/7]_-|L>KeKW{P_h- E(&Um+d=m2d+gpTuԍ{rkZS,((0[B rvH:14ݼbGLdQ@;&ZW cT#I-&5XǤa[LPjCq64`mh$C;j$֘(c(A61)&`&L-&5MLz, Ĥ )mjV L,Yʼt:ͽPhjkT(:jsTQX'\_mI6m2i>R- qR6"LQ&e#Ȱ1&AGU.FA;bPQA얡JA%AWe*.  &z5Q0XXEMjO6*>F=Sa'=tT^*s> s`Nb%u<:X![X&\8s2xTtߥzJ792plϮ~^>ɖ{A %bmiTGY@^`7&*S rZh[`/s9@/!NOTAn.MApm> stream JFIFC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222=p" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?MҬAh (~}SG(~>}?A@ɣ@GP_yP}(~>G֏}?AE_}((~ɠ(~QhQx(h}?J>(/ʏ( (}SEOҊ>G >Oҏh}(~ (:(>(}Z>}?J( > >MҀEOQ@Qy4}Z>ҏ((OҀ(Ph~}?AG4QtQ}Z?&~hx >΀_֊>EZ>>OҎ}?AE_֏΀G⏧G4Qh>}?A@?Z?4}Z?ϥOQ@h( (Qh>}?A@ɢEOQ@}SGP}(~>?ϥ@>ҀEOQ@ҏhJ>(~G@}((?ϥ_֏GQy4Qh>}?A@E>Q((}?A@M_րh (~h}?J(~QM}Z?ϥOPxE?:>(<>OҀGQMQh >֏ɣPh ((~}Z(Qx (}SG⏧(<GGQ}Z?&?P}SE?}?AG4wGQ}Z>}SG4}Z?ϥOҊ>>J>rhh(QQMȠx (*>@ (~tP(?ϥ_֏OQh(~J>4}Z>EOQG4~t}h~(>_}(~P>@֏GҏhG}(E}SG ;@Qt}hOҊ?4J>}?AEOQMZ>ҏ(OҎ(@4sGw?4(>}?AG}S@揯KIxQG4J?4(~@}SGGQ}Z>(~w?ϥ_֏GQMΏh( ?*?4MQ@QMGG4~T}SG~ =(G ?4}Z?Q((J>Š>Ph>}?J(~h<(GQM}h >}SG?ϥOQ@QM>QxQhG揧E(@OQޏ_JO}?AG}SGҀ?}S@_}(~ ?J;@4J>~M_֏@OҊ>΀ >ҏ(g𢏯hGG4}?J(~>G(~qG>}?AGsGT}?AE_zOҊ>Ώ@nSG⏧(󢏧(>}?AGy4Q( (@Q >}?J?ϥOQGEE_G(G >hG ?QM}Z(~Px}SG ?ϥOQG(@h>}SG(=h>}?A@(@?P(?ϥZ>OQM}Z?ϥOPGQGo>}?J(~֏E}?J>(>ҏ(}?J;xQG4Qh>}?A@8&>}?J(~hxQ}S@?:>QG}(Q(QM>ҏ(G>QG4vOQyh(>}?AE_րhEOҊ>_֏Gh}?AE_րhEOQ?ϥ?}?J>h>}?A@@(Qx<}?J(<(J>QhGP(E}?AE_G>QG@4Q(_h~~ʏ(Gx >QMҀG?OQ@_G}?AE_րɣ( (>(~}?AG >@OQ}h?Go(~PZ>_֏G(J>=?4}SGQ@Qi~'oG⏯h}(~M}SGQ@}SG@E_GG}?J(Ph((G>@_֊?}?J(@4(~ր_h~v"(>}Z=hGQG4PyG}S@_ڏ@OQG (<h>}?J(~ɣ(G4Qh(Q}Z>}?J(h>}h~}?AG >Ί>ҏ(@4J>}?AE_@揧G}Z(_>}?AE_֊(~>G?>M}SG ?ϭOҏɣ( ( >J?}SG@EOQh}?J?ϥOQ_Ky >}SE_֊>_y (< (<zGOҎ(PyGhEOҀ}OQGhQ@}SG(~h?ϥOPG@4sxQ@}hPy ?J>G >(<@4J>P_h~Q}S@?ϥOPxGnʀEOQPG揧@>ʏ@_֊>Qޏh>}Z(~((}Z?4h(?ϥ_֏GM}Z(~Q}Z?4Q( (΀G⏧(}SG (}?J(Q(<}S@?ϥOPxh<M~PGPOQGG?>EE_֊>}?AG4h~J>hEOP(>}SEOQ@}SGGQ_ր֊(~ ;h>}Z(~hhP}(~>Q>Q( ?4}Z>}?J(}Z(< >Qy4v@֏GPxh}Z(~?}Z?4}?J?ϥOQGyEOҊ>PyQx}Z(Q(>}Z?&G>hG >}SEOPGQG?ϥOҊ>G >Oҏh?ϥOPx>_G(E~(}Z?ϥOP(G4PMҏ(~ɣx(EJ>QG_x⏧(_h~J>>(}?J(~>Q(~hQGE_րhG>>(~>{Pxy4PMҏ((G(@_֊>QG4J>GhG4}Z>ҏ@4QG(?<~T{֏EM}?J??GQh>}?}Z?ϥ>OQM}SG (< (MҏEOҊ>h~_GG}?J?J?4}hQ((<>?OQG4Qh>}?A@h;gGG揥>ɠOP((OQ@Qy4}Z>ҏG}S@֏?(?ϥ>OQhhG((~Qyh>}((h}?J?ϥOQG4QyQE_}(QxP(GQ}Z(OҀh>}Z?}?AG@⏭(>}?AE_րɢ}?AEE_֏OQhQM}?A@OҊ?4MҏEOQG>__֏G~OҊ?4}SG ?ϭGG@揧G⏯h(>>(<>(~(GOҊ?&@4Qxq@M>ҏE_րE(}SG (?4(>}?AE_ր֊;QM(}?J>(>Q(@}(G4Qh>}?J>Qy4s@4~toQ@}SGP}(~Qh>}Z(~(9( ;hEOҀE_}((~Oҏɢ@o(~>(@}Z??@֏OQyhQ}?AE}Z(OQMΏEOPPyOҊ>GOҏ_Qh>((<>(~>֏EOҀEG4}SEOQG(QQhG 8>}Z(~_֏?ϥOQGրGE}SGE>xE_ޏG >M}SGEOQM\4}?J?ϥOQG4Qh>OҊ>h (~h(>}?AE@??Š>QMҀG=~@_yP}(~?4h( (@Qx}Z(h~J>>Qx(>}SG(< >ɢ(>OҀ >@_֏G}?J(v"h (~h>ҏ((QzP(??@(4QM}?J?GQhQx(ɣPh~}?AG~S@_GOQG(~PQMҀGҁp( >(G4Q(Q}SG֏E_֏@Qx}Z(>(hQ@h>h >( ?*?4}Z?ϥ;}SE}?A@(~ʏ(QM}SG~w >x ?J>G >}SEG?>?G4hE@h>h ?4}?J>@ (QxQhJ>< (Py >_ޏG~EPMOҊ?ɣG >}Z?*>ҏ(ȣ ?(Oҏ(QM>~>_֊?}(~>Ph(hGG4Qh>}?A@OQG}(~P_֏E>>G >?z?4}SGo(~P_֏G}?AE@}Z?ϥOPɣ_}(~>>OҀ >@_֏G 8?ϥ_QM_֏@OQGh^( (@G}S@_֏Ώ@o(~>_GE_֊?4}?J>h?ϥOPOQGhQ@⏭_֊?4}?AGɠG (@4ғQ@h(QG4qGQG>}?AEG4h~Q}S@_֊>QGGPG( ?ϭ_ր֊(< >}SE_֏Gh?4(EOQG(Ώ@4vEOQG >OQh}(E}hG(h(~?h(QGGOҊ?4J>}?AE?&GQ}Z(~?4MҏEOQG?/QMh>(_}(~q@Qy((J>EGրh (~h}?J??GqG4Qh~QMҀhQ(OҀGQhEO@QMҀG⏧(G@OQG}(~P?ϥ_֏G}S@h>}?A@4}Z?4J>(Ph~( >ҏhG(ҏ(>(~QM}Z?ϥOPQMGP(OҀGQhGҀ(hGh(~GQGh>~}?AG}}Z>OQy4QMҏ((h>( ;M}Z>G4Qh>}?A@Qy?ϥOҎ(~_֏G}S@_֎h~E_Gh>( >x (<GG}?J(@>G4Q(>}?AG(< ?(>}SGG}Z;M}?A@OE_րhGҀ(⏯h>h~_G4Q}Z?4vQ@QM}ZGQtQh>}?A@?4}Z>Q( ?&GҀOҏҏh⏯G ?Qy4PM>(:>OҀ >hG}?J(>(QM>(~>E(~w@揧GQM}Z9(QG4wG((h<(OQG(< >G??4(~@_yP}(~>Gnh~P(4}SE>OQy4QMQhG?QMh~}?J?& >QQGMҏEOQhGQMh>(<(yPGQM<}(~Gz?&>Q(h~J>>G>QG4Phʊ>_۽(~w?ϥ_֏GM}SG4}?J(< (}}?J(~QMG >EOPEZ?4MҏEOQh(~Qy4wQQy4PM}?J(< >(QG4Qh ?QMҀɣQ{!G4hG4QMҏG⏭>Q((4}SE}?J?(<}(~EEGQ@}Z>OҀ >QM}Z(< >}SG(~=G4h~J>h}?AG}Z>}?AE_@Q_Qh ?:>}Z>}?J;@GGGo(~Gh}SGo(~>h}?J(~QM_֒(}?AEOG(>}?AGG?(??@(QM>(zyҀE_}((~@_Gsx ?>}?AE_֏@G}S@_֏GQ(Mҏ}?AG揯E}?AGQM֏G ?(PMҏ({~h}?J?ϥOQGG< >M}Z(~@ɣGQ}S@}Z(*>h>}Z(~(OP}(~>(OҊ>PyGQM}?A@OQGɢEOQGPyG}S@_֏GQz>Q( (?4}?J>GQEZ(GQOQM?Q_}hJ>Š?&}SG (~h}?J?ϥOҊ>ҏ(~QEOQOҏG ??GQh<ҀE_֏@(M (}SGG>h>}Z>}S@_֏Gv (MҏEOQGOҏ >ҏ(֊>({~_֏@OQG4qG֏GsE_GP_{~J>h>Qh(>}Z>Q(QG4PyQx}S@_֏Q( 8@4J>_֏E}?J?}S@_֏G((Q_hEOQ@_yP}(~>_G>}Z;{Ph~_@_֊>(MҏEOQAMGG4QMҏ(~}Z>}?J(~_xGG4QhEE_(>(GQ((}?J(< (EʏOҊ>Ph~}?AEM>Q}Z>EOҊ>;sx ?& >}?J(~>_G?>Oҏ( >ҏ@Qy}(}?A@E4J>}?AGh~Q֏hEOP((> >>ҏ(⏯@EOҀE_@Q?}SEOҀGQhvEOҊ>Ph~}?AGEOҀ}?AE_րh>}?J(*8(<(~hڏ((h>}?J(< >}Z?Q((v"(Q}S@ (hx}SGOQM}SG?>QxQhGҊ>E_֏Oҏh}(~ ?J(}SG~PG(~q(J>Qy4s@4J>Gh}SGj>(GQG揥?P}SE_֏OQy4(OP}(*(q4h~}(~QMҀG >΀ >(EOQG9ҏ( ?ϭ_րh>}?J8h~h(Qx;h>}?A@QzQtPy4J>h}?J(~}S@_֏G(?ϥ_Gq@QM_֏@ 8(@( (Ph( (?4(< >}(~QxGQOQGOҊ>G >({MҏEG揯GҀ >}S@??G(}(Q_h~J>hEOҀE_}(hx >h>}?A@OQ_րɣQ( (>ʏ( >Q}Z?&G((OҀ}?AE_}(< (h袀(?ϥ_֏G}Z(Qx(??@OQMhQ}?AE>QP_֏E(G4Qh>}?A@?/Ɗҏ( ;?J>hJ>E_@( >GQ}S@(~E_}(QZ?J>@(>}?AE>h~:>M}Z?_ր >}?AE?&G(}(}?J>h>}Z(~QhG(_֏}?AE@}(< >}hG(9}?AE_y}?J(@QM_֊?Q(@}(~P}(<(~ɠh>}?A@OQG?ϥOҊ>h~v>>?4Q(Q}Z(GPGPGQM}Z?ϥOP(OQ@}SGP}(~>(~QM}Z(~?J>>ҏ(@񢏧EOE_}(G}Z?J>>ҏEOҊ>>Oҏ?ϭ_GQv>EE_@֏GQM}SEO@>PMҏEOQy4h}?AE_ր?tQGE_}(}?J>h(~@_րɣOҎ}?J8(x >GPGQy?ϥ(~_@揧GQhGQ(@~T}?AEOQyxE_G(~Q>OҊ>?4}?J(~?& >J>Q}h}Z?}?AEOҏGҏ(yxOҊ>ҀhߥOQh?ϥOP}(~Qy(ҏ((@4J?w (@oQ_GQ>QhGP>h~w(<}(~M_֊?Px>(}Z(~?/QM_֏@4}?J( ?4QxEEZ?}?AG@G揧@{~>E(~QMҀOҏ(<(>h=h>( (PyQ(<(J>hGP>?4}?J>_G~M}Z?:>րGx ( >}?A@>T}Z?:>_y@ (QOҊ?Z9T}Z?}?AGP}SG揧(>}?AGG(_րh ?ϭOQM_֏}?J>_}(~>}Z>(~QM(~@}SEOP}(~>OҊ>}SE_֏Oҏ@_GQxQhG(9G >h>}?A@4(>Qx(hG(Qh>(Ph (~}SGP}(~>EOP((>(P}(~>>OҎ(J>(~M_֏@ ;hQ(QG4Ph~}?AG4wAMҏ( (Mҏ}?J(<9(< ?& >}?A@J(}SEOҊ>G(>OҀ >h⏯G >}SG4hQ@>OҀGQh?֏h>}SGGP(~J>E(~>Ph~}?AGGGQ}ҏEOQGG >G (< (<MҏEOQG@OQGQOҊ?4Py4QPG@ >}S@_֊>QG4Ph (~h}?J?ϥOQG4QhQG4Ph~}?AE>>T}?AGGh>QM(~h(~GQhGQ@QMҀG((R}?A@ҏ_}(~PMs(?ϥOQGG?E_}(}(~G揭OҀGqG(΀}Z(~QxQ(~P}SE>OQM}Z(~E_րh>}?J?ϭG~h(~qGOP((>_h>}S@9OP((}(~Px}SGPGG}?J(@4(~?J>G (MxQG4J?4}?J>hEOҀ >@4sG>hG( >OPGQGh>( >}Z?:(~_G4J>QzQE_G((~>ҏa >}SE_}(~P_h~J>hE?QM}Z>}?AGGPGQh}?AE(<(~h?ϥOP(GQ@G4PyQx(J>QE}SEOҏʀh(揧((<}(~E_@4Q(_h~J>hG>OҊ>hGhh~P}SGx >h 9>}?AE_@揧G}S@_GQQhQ(@QhhGOQM}Z(~G?4M(~Z>hG_GP=A@>}SG~>h}(OQ >ȣ ?QM}SGQ@Qh?4}?(}?J8G4h~s~G4hQxQG4J>>ɢ(>֏@4Q( (}Z(~ɠh~QxQy?ϥOҎ(~>GQMMҏ((y?ϥOҊ>h(~>G(OҊ>PM}?AEG4}h~GQG}?J?>Py4(~h ?ϥOQG(~P}Z?ϥ?}?AG4QM(~hE(< >G (@4sx (< >@OQG4QhOPQh?ϥOQG( (Qh ?QMҀhT}?AEOQy4}Z>}?AGG>OҊ>T}Z?}?AG@_y ?ϥOQG4}((9G >h>}?A@OQMOҊ>E>Oҏh>}?AE__֎h?4}?A@ (QG=J?}SGx >΀ >G(MZ>}?AE_֊>?@_GQhE_֏G⏯hh~J(>( ?&GOQ_GnZ?ϥOP(Qy4PQ(?4(>}?AE@_֎}?A@ɣPM}?AEGG(G?}Z(>ʏhG@ (}Z(~PxQM}Z>OQhGQx@4Q(((}?J?h}(~ΏҎGM}?J(~_֏ (~(J>E(G(:>OҀGQM}Z>(}?AEG4h~~ʏ(GGҀ}SG}?AG4QMOҀ}?J(<M( 8((~}S@_֊>_G((<(< >}(~hJ>}?AE_֏Z>@Z;Q(PM(~?h<(>}?AE_ր >(>}?AEG4Q(>}?AE_ր ?4}(~(G4J>Oҏ(h揧@o(~>GG>h>}Z?}?J>J>>ҏ?4~_EOQGOҏ( (A@}Z: п7OҊ3M>^MOP};fGM ?4vj>Px?GN(}SAҀ ?PhRNOҊ\u\4}?J&4QM@鞔(*;ǽ_ۿhh~h> (x QFɠ4v"h~h &y}Z(Eƃ_@鞔g>vQAh>}?J('Px}Z?yFyQM(>}?A@AhP94}?J(APh~jL4}SJF)#ҀG@SE@(uGϵ4((9?APMGMOҏA٠(@;f3@@4P9FyGxh>}?AGSA<v 4}?AE:~4}Z>jL@ G4A=(Qh4}SGj;fɠ (<uh@ڏQy4@zPJ?8;P:P:\u@ h~@_փs@xɣP?*;E€ >A뎴Qi P(<>Qހ(:vȣP94Qys@h<~4Mu8QM4QAhK?ʐrhOҁϵh⏯h> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222Y" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(AEPEPEPEPEPEPEPEPIKEQEQEQEQEQE%-PEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPIKI@ EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPREQI@ EPEPEPEPEPEPEPEPEPEQEQEPIKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI@ EPEPIKE%PEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPREQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI@ EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPE%-QI@-PREQEQEQEQEQEQEQEQEQEQEQEQEQE%-PEPEPEPEPEPEPEPEPE%-QEQEQI@ EPEPEPEPEPREQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI@ EPEPIKEQEQEQEQEQEQEQEQEQEQEQEQEQERREPEPEPEPEPEPEPEPE%-PEPREQEQEPEPEPEPEPEPE%-QEQEREPRE%-QEQE-Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPR@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ KEQEQEQEQEQEQEQERR@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPEQEQ@Q@Q@Q@Q@RPEQEQEQEQEQEQEQEQEQEQEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@%-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE%-QEQEQEQEQEQEQEQEQEQEQEQEQEQE%-Q@Q@Q@Q@Q@Q@Q@%-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIK@Q@Q@Q@Q@RR@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ KEQEQEQEQEQEQEQEQ@Q@Q@Q@Q@ KEQEQEQEQEQEQEQEQE%-Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPIK@Q@Q@Q@Q@Q@Q@Q@QEQEQEQEQEQEQEQEQEQE%-Q@Q@Q@Q@Q@ KEQEQEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@%-QEQ@Q@Q@Q@Q@Q@Q@Q@RPEQE%Q@ E-RR@Q@Q@Q@Q@Q@Q@Q@Q@Q@%-QEQE%-Q@%-QEQEQEQEQEQEQEQEQ@Q@Q@Q@RPIK@QER@%-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQIK@RPEQEQ@Q@Q@ KEQEQEQIK@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPEQEQEQE%-Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPEQERR@Q@Q@Q@RPIK@Q@QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQI@ EPE%-QI@ EPEPEPEPEPEPEPEPEPEPEPEPEPEQEQEQEQEQEQEQEQEQEQI@ EQI@ EQEQE%-PEPEPEPEPE%-QEQEQEQERREPEPEPEPEPEPIKEQEQEQEQEQEQEQEQEQEQEQEQEQEQI@ EPERREPEPREQEQEQEQEQE%-PEPEPEPEPEPEPEPEQEQEQEQEQEQEQEQEQEQEQEQE%-Q@RPEQIK@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ KEQEQEQ@Q@Q@RPEQEQEQERR@Q@QEQEQEQEQEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ KEQEQEQEQEQIK@PEQEQEQ@Q@Q@Q@Q@QEQEQEQEQEQEQEQEQEQIK@Q@Q@%-QERR@Q@Q@Q@Q@Q@Q@Q@Q@Q@%-QEQEQEQEQEQEQEQEQEQEQEQE%-Q@Q@Q@QEQEQEQEQEQEQEQIK@Q@Q@Q@ KEQEQEQEQEQEQEQERR@Q@QEQEQEQERR@RPEQEQEQEQEQIK@Q@ KEQEQEQEQEQEQEQE%-PERR@%-QEQEQEQEQEQERR@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@RPEQEQEQEQEQEQEQEQEQEwEvsEMP);E)Q@(<(4EPR(E(袀9Q@ ޔEQ@xEwSGj(R((JhGz(E֊(M(Jx;P(Kڊ(袀ڊ(;h(A'|QE^Q@=hsEOJ(tE;QE PPw4Q@jP)hQ@(h4Q@ H( SE袀 ^Q@'z(@JSEvPxP9EȢN( Z^Q@:R EP((;EuSGj( P9N(@CEi;E-(;x^h)E NQ@ hEEh)OJ(Rw%P((H:EKڊ(EP(()MPړP;QE AEE'|R(tS%P endstream endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj [ 13 0 R] endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> stream x읇eB*ޥjյҪz$D@4 Db&'vC&$N䜜{17/vVIy>g.}uq1ձw֍`;?>??_߾~/oߟŽnWfr^[60T-˚S_(Ap}Ca+}fmr:b+sdaW6 30-kw_*fj6h]oV IyE~=qa ܄’ԊTs;>. G$7̰5g-9*53. UVPlLu SV!?Z@>,>;>k[B390ô %D&CU+ҫlUP vvKvJvnfH즽-ǚBi:;ې`ťo7Vx~nn?}My[iazT%3?. Z&A`{aD5x4eVri0rǗ_;+cxԤl6v /0̰a>~<ƞ K ІKb /]Q;y܍4ʬ)<7 V<9j?Pvx~y- =.NC=e[ZO0̸@S0L` PPwq?W*9:8VrqjW@x㙹ƿ,:_!pq8bqe[rc(aEC I%l?(>v W1-IHHҴjgC%00q9BXH ^~WVxr$8?I{q/bmP\ZNMjP3̽-$>?6bִy{rZ,I->IQՙ]͇APEsG\RMV+BSa;Q³Vg6>x\f&Sѻ.3̰4 %fƤO7W7,$Rm㵘r`q{\燮RQfdN˷k;>\O_<Ҏ2^[ :_A2 [+ `"hpSͶڬ=ɒZ$)e(W 1, EM^eוv;oӿzv;S=ZWGHfEp\bߐJ ]|pa$ crGkag^b!b@x16Ȕz&i3sf]~}ujWxc^[uV( #'~ `~}ߝo:}+yAtK~GMVYj/V^ Z sP1GP#w @ NK|o6R;koogadB3oDQ ^UXK/tnh/>S:xi8,v#\#4p 3lic9$Bb =9:,91StLfUr[v2 Z\ݤ~v7ɮNyuX__׌V( ~ZL LchOd`|(2M:(L. #e2 j gtzb[ᱏم(3%@ Wxo]Z&X{/S|G ["8MLaͰd&욬Ƽ6xj Wl7ؑ*7ۘE]u ڟ:6w}mPnѻxo ^= c$c?N : PsO,;x+Cvz>!EJmy,-|ւCWk܆eVY?G\C [V[n5< G$ҴՙZ$b]v3H+5<\:xY]\Xό!gaWPs]C\T 7f}I-^wó ll!s%ݒqB.hmU;9;E/\Ȯ{iÀ=;>P1({[_ֻpba`3߸q"iLnZfpz+}pN~QQ`>wbaN(,kn)R(C@]>Dvɶuk {ff(z3˜zNvp}qkI8 +Woa`a ,Fp !,/)aڠ#Xrvl|=Mx ei=e[{{+_/t _8Ə0;xaZpS~aKb9129%Ɩ-pE93.*^! lmm7Oif{qjyKAg{qoeFmNBĢC?sYL>S٣q*z_bnɆq=fԘ87WύwG- c)8q{f\nMV5 I 83xyA!ށi{OdfvcuKPK;n=o0cgt"NO˿ 4ږSclL'ªuM(U`S(Ŏiܲw*zN6<>TRq[%-<׈)| c Qa5J'GD}k b:l[v،oaa2 ,ؔg8XTR0:Ȭvܥ>0w~!Ž*ҫkGPv{Υ3؞^jZ<_+~4]]֯[FRap89*5?1rAmvCOXԡL "=|/ K KA>ůt'P-KƊ-FA.! 9Юz|2Rmx \ dHi蝤?emH C4Ltf76緃нZ&ڦ&Zhm;vOwv_C4n筱7]mt a0;;y{E|NiErdzOL9YW~)]XUuU*Q 1ڲ f~ Y#|C'ErndQJ"K&x{[B鱙e%Ս~kTN=SxCjÉ0?;K]n~]l s `)s%6;!屨V^)~?(> |ԬC;`.r6_H9>D߬|~j8QLىݰW\֯[0:lRh%k{u1_?h8:RPM' w}ɥ,q9}Cd89[: #018f+g^sC$q{)4&86'n334yi5q9l NR1K,Z[1"cX*~2h^eRh5 { %*-]}8d'B~IsohiNhe$ɺ_:M(h-XARޔhZV^^UC%_Z??ET=}F-3?/нpEK]3/9ڸ Gt0: 8y"0/r_6 Ć2dF5*1K3K0 Ͳ.7A} V]n~@yٌ4sSN|~nB$)oK{Q:Ov/u:;~{qÆ)ZTmSB-9-O$>n_\y % !n+S qlc,31l|k,]r~?<Ξ 37 ݒSũ從`qYJ 'Dym㳿!ry_^XJl7ny{vByF+X(^YCnysvXMN#o-3蘒"x&(VU:XߊzU׌{h|Ȕ*x .U!dFiت2˜ ^Zoj0[pEE;ׯ[ϯ/l7Gs5129;>o>,fSp;L}gnV=Xr~%5X-RБՆ BCW󙆨,akhFDtWKh3 C|>qa Q˙qq9 IqrR qʖ\6ym.hWY1銝ņ ;u85P[y3% n3$;)*5՜zDs aH .,c+y'.p8]Y|DD@   wZOj*0#ʆn![=MRBklY28 2 qIH(d!)6hV,|bScYݭa_qb]uomc,5f/^.>=C%͡ߏpwڇ}C$hkBd24:HW.IJճ&ԙ zjũ)iv).\R&Ɔ_ɰcx\_'fd6;ߙLSH_85AP(ťbs @NLv5iEƋK_꿠׀{ܜ߮} b|^lX󢆭r!D  L.=|$_/,fmP"IJ~We77ڬt@;(ouMXk&/ 俜v}#hOi`@wCLa@%" */ n^TPF!4NL,F{k*9(LzgP׀IW1o۪vnPrKJ6cXgSns̟>{w=n}8W+U)3 LhJ)F׽El,oPkdV\< W_/|rgjVZp dufbbLɐcت5KůNt{sGNIȕD9-x7t'7V$ Rd]! L߻^fOܗɯ%$kk )&\)3<g3rt^԰`t>:{,){gOC}8zyWv5q9=*tV ozmmdUwp>:o)1cCl} Wu\CwJM6luM;Z5XNv[燮 vWvM4?:;6&?^O']7@m-|ʌZq_mխt@r[k; [=g[σ3_<8GNj?/_I ^:ʹmo]g2FH{:lADMsOu]n~u4Cz*ҫuQFcr[I)]DkL',<[E7Xq/e` ' xT>-nT~Ym9 S\d WFzKƗT6/Ǘ3vw FÄPeYsd%7d6lΨAԌR\RR6"SRŴϨ ȱL 5C?<\%Y~!'fO_8=pK$דJP8|C<P9ڔמh cBڋ{Y[0+VF'Rx@$J|D"\K`,Ŕ ҴT@1B J{JUfj4#mi¢46miҜߎ׺ O{QOGq/Dl&Efy]D9v5B5b_xFP }d4M є&),=7 lG3>;zdu 7|2Vݤ5==gQA(#ҊEz&O2p ήҁN'^Jk|(o%/I [c=3j-_GN_Kvx`n*\J9yl{h7^!kO?LEhqzjM$#dvn [)C _3).`Cˊ"5vƚaz#9'p{>ߊ f;;u^bZ3,;LU Xqёf?˰ ߐŖa)V;%ĹP[ňIV, 'fo?XlcrɂVWWh~" j#&8 S+ǭnOV\k$ӀO O`5X-!V_Z\ՄuRL]hPkF\1q0%"1Awf YH@- ,ej0ύmU;a1<%iïI^yݩGˤβ EqջE8OI*0lGA+cud_L0lUYOUfRjŞk#wz._*ukF/Dɾ[_ьpxXL^j3% V [ k@u+ .U[0pdVM}}tS~eRp/VZy8$X6E#a/lBxB2ªv:EKی"'GFkeT4$g,{nܤ;yc oaSa4TZCN*Ʋ-0[{D\HD@1G,Vi$&e?>xe0Zy~5j:8j":f%,dIxȏN~<.Ra@s׋7~0?[."y jLaZ01 o4D| G",J);uZgvY$gW{}Cu9&/?/܏Hj[JMϲd+^BgC ~פA[ٶ"w=nӟ^#Nmjl& u*<3ʂĩze;Wm kޘ/Sju1^ 5LL>:})O^ӂ~k~ڊ{\vn.5 hYͰd9lWYdA¯~ ⾙ˋO77-o4L4tܦ- w^|uՔ (%62l>9on^BٸJ%3'k$W q+z,*yn~+/}x ܶւN65Y [S^]f.KĻ%}S9A4Nqvw@_eB…i}ָxabd2KfERvƈlK3gBg[BLd$G&D$&M`w6_B6K r?h2+ﭱz* x[H|n3EM ^xeJ[ZpED; 002BZT `I8fKX<5<۔T X/`$,Geʩ|PL%;>`ZÓ"p_57lu=Z`JǡC _lZ3Q`APRg]3<xWm0.|]\԰,k.=ۊC$~|׷i:r- E ~  bE 0ULdzvË&G%F GJ~R_MIP)Wm`$)161lEeTm\lEpg;{gw#y}ίo[a7l 6)duۊA7d KB*Cv)Mےdkx1*"!:9XSU6K&֊=:&Ntn\ĀKa/ ȷt"V ǔn,Upȗ(6gH3/_XhF@1y*'h w:zu/*e! Km:k-~A?sl E\ @+ᅰ HEoy'ӻ,$1+FuHK,i#M̉/n  fh;v hK=Moxᰳs [);7}8xAJL`k.EFP0pP5ty;EEfݾ|_Mlm8!/\lTG9 l_d ӂ ׭.MB: h7:xi(WkȪ2uX>%>\lP.v۽-p\ց_JV!!"_m^6OJX>#,t7c%Vs&E pM^~° 8sIC1S*+> [AD~j 0BW77OJ! )kŸF\ :|k'/9C|٪Vي_ 5fC!:g :t+6pynW,i04le>{p؂YI\ET7O~-&1e@l4s[WNkl}sy^|/0t~a:nظaKȠ in1l_=QL=f)$e Y_27[j:|AnGId3PKKMls~H39V9p0'SX?B-aH_O&hnf(˸O\װ`xٔXE[6u݊aօAAbrsB )}&,u(l8 GPg VL|SmWي3)=g&iƻ8aVDx\wo6ߤINH误dZW- / ͦa+hwrb-4$lyuvn2&Vx 3Yl5#cWlxf+ j;@Dy(9|XTaH2ᴁ`\NH?V#!Lg%# [=_;/|{$"/+/i78~w֍݃Wlf5&D&~!jk6,eh')lEOhqHw&\xeAỶId\Rlf(w L^:*@wMGaK~⻷er"c;jPdsMVc|xԡӄfW7OѲ)V< 3bи`3 6_ 4mqbȩJɴOO{_Ө06"h(LM|!}p~ÕI" i +u$F}O~k&, r[XVjgFBi#"_?s.^i j(FZ'渱}z;2=4~^|HvՍIw ~0Jhv0SbiR_YEX# V,lW⫰qf7&'wmͲ汕xsf^1.INN)2^%$V;ťT# IUy}{geUq T bD|  ((PF @EM"&1 CmQ"jԘhLo#M^z>j׮]5ئNm[MoUyArFȯ] :g̚6tW1@vۡd6juQHLv[7 ~feh0m\Bgv95 j~^[2y)(Wg;gHĹK_'rլ`&$+FSoacFȌF&! ss9tQ -84_M[il[ RtvL# #}NLZa6 6ut;rm׌o,dI"S&.:;N cbףs/RRcwrk9(|݃u*ikL mpA=}mZŲej*[Q˿;ѿLV h$w,$};&J57u .f0T"o J8ҹp$NY |]&8ġGۡk 5}t\ZB?I(9Nώ9ҕiMs;7e@i+2r kFEy-<⚑N M[a|_Eko"3{^USVޭɮk$ELual*cr'=42zvx[m4om}WYSj9}6{s85rAn+96 JV,c|kgႷ%ˋts. |X֪SYYBs[ i2T7'j{(HC)Zh-Kn|7 ,] c^&î pՅ\ Gwp~ R.~c 7'6 &e^a'rX!bmB΍oNO;g1Vs̕o2:ҹߺs:G?4O󹢶/} #'=XX8', vP rpAN9KmZڱCu}VqVSܛ\jС&{6Ցm[CS^vkLC_mte9J&t2$ܵrїvG7Pn;niȆ6O{wsh+|ɭNzY]# 9e(W{3%ّ짴*~!e'rNx_zs>8'Pu sMd]j7z{6vo_9Md|P8SNA ۙ`jK^{CV8¯k|;|5sr;rǯٶҔc}fs9pt 94sv|#r%D>,G{S"xױ&5t'7%'O[wj*8@o7)F<:(27&A ئO[svo"+~|]9lL^Ss{sjBDߢ|z7Hs72 utTW8@`̆ M[sx׌wFozUG$Z퐥3s9K`CV;| ;|S$/nJ2NĺsΩnnN[ V~+6'( sNiYM9ٓұc;K.Ѕ|xhث!99K*iߌ#=6N >! a7p{(o{s: '4gddcv'.,.kR;,,xkˡMk^OZ s#EYfi+.U: qu+: esR5E'~EW#c ChqױJ#i+kqG,xtlo+XW]2,~ixBsoLɱA6siCl_Geyk|C]8ͨ̕ ЈFSw4l94 q(?P?@qêbVpĥ&ۖG&G. L*5/Vŀ>'<{)ȊﮮCS!Beu9mZNŪP+_u/Sez~[~)_>K\9~-v*Ζ4EO#%U7?s(V58G5}ԿY .Y%Bvg~.;zڝyI+ ir.>1_",YBʼ(D?go3uOMޯ%|_I-u&}7KII*˔Z*mW4{MYDE|%{og! &߾FO"I`~e7'B#˦#m/P!Zꩬ+cÉ\m#"+-J9.>o 1QS7/k~J'@QɿO.ſh҂PUzxq nq 7vJa-VOE0yy}gӧ*"X~zK.}0Yv͖?26gu]ZnL&IB8!hASІ횻 $3YJ˜Ԕ4 h[O|Qb>#-i"9qP"E+R8Ox9}r.rҟXr@V%-@D,PL5o<;$wReu9tNY~&?W~z]$Q4~>G \6iaB 2e~ݺ@0q7[N;+W>&'H"ʸ"XBpngriomDQB+WU$$BAVv؅'q A<%ʒ4RtTGhi̇1Su+TQ -Je7o\i?VׯÄ8[Ï880T((Bl/|iEh)$ uY ~u6W<ǁ  PqZYu:&eo^}i3)"+:yu*1<)†LH?$$Ɉ6eB-ɮ;L_yհKLlVňKfIx%Q 0BhܖBG*MN89%m!a$}οb]7I Rźd&o"!L7*ɀV`ʟ?vO2>ADK&!Mvh1aErżϹ}KOΔʇ»'K&L@dr} GU_z/~ +}@̝ڊ% DN/|fPUm;ycnJ 1%WNs'w]GbH0O:+_"txgHˤ I;=Wr.]dmV}ɰxre͆\z=%NP_} t"ݑa _jȠf dc7?Cr=$m&@D.E쓊ћ~]Һ)*b&j͟^FiZzL'$}"G^~1^T1wBE{{[w̾9j掮3L9C=ysGwhlUD~w) wJNX֦OgLd͏/y_IԵc78[g&S.4%RD܁"_j<}Ig'n=~LG>oۺx~ia$)$ LNKFr^ };{rװw6}~l&ݴ`O[r#@6RQš j(Zsŵ'5 >ሲ,ć bf茚KW||KD|&~:~-LȚABWzxzIW)KkW| ܛo~u_rX@v(WO+B|H5Gi`-oreege 'Je׊}D,P~/<"nkĝJ$֌_\G{H{Xs l]1*s;wU-r-?%BE8:IA=Ԍ\DBW9 C \v|\ьnU׺,نXm.VIe796>μPFpi;0_13f<ʅ裓(# ^(_܂K,G~}*e| mH!}H(׮8EVU3%R+ Hب56q!FCM'0d 2咧t!V|w%G'!4cc!_.w5 ԥgaïp&U=Zǟ7j$Ѧ=<.m)Vv bwͬ &IJۿ\F`ꥵT^ ]I1e|e! dc%;H! eqSbfpwN(_I{/BdCۮ/9`y{k4TÑkfa;;34;$iӛ(y*~`Բ7*~K{sݤ+z9傮+tVA,'1;K/%R ߪ`j'+"pצUDFu%U[wFbSyLߘ0LrPAj/mϝ]`Ö'Љ__!3az*{@y1n=e#FoUPŚHoZU䕡dPa^|;R,DݷzE Q&YIK6:4On(E-鞳qma8_\n֝CK!y!k5 pjR[eȀ]HKseSK,+Jr͈b4~zf"-[:zVxX_FOyirS+p ۫KN >zNnT^!*hlk:Q5*c{8[Us$ͺ[UrZBk擪q*djKk Tڴ ]VJvBl; M"U_T!s*4d; 1#KB&|v.Sѥ(-;Rr ӝ:fR,]~2| Xz?&:uchz ElJKN!|Ƶܽ.fQ{5XVNM4_np`}nYdyh۰h>ZgWYhEh/G $qgq52`iўOnW'IPL_nI~Pzׯ׾e~om0<|R! ߪ`Lx4R!F;ltxhϵϞISFWw4~v/][NbEC׊@] GQ*iubk ι^i>b_ʲ͢7ȷBwhJf۶˚YBv9 G^Jqԣ>ҨLkz,~JATj5jE>/eC/{CvfFzt9d/0zozOh^x0jc> x82#pOW~ڶng#;s>JTA&QREUV?բVXǞ8IV ht9OEN;K ɜZQ:êR f*܀]+i/rpb#͜rʩHK~fˍoN95- |SNG 1=2)6bQWTN9thԕu)iەZ=f endstream endobj 17 0 obj <> stream x} xǽgh.ݭu[Bj!B  F܇0_,Blc;<{_Bd$v_$n>_&{zg_޾lUuUwuH Gpx" z !=~Jy G)\_̃ 28jky ֹ.@yZj@Xe>\_MX vAp8얽6z| ~\_c5;Iڞ]v`Itm%Эu8yysO׀+2zN_` :`;@jhƲ->8l#Y5ټ9DsS/mh- y=Qtkۘ#D6l:K+1z>E?ƣ{ B6XP[*>sGf$߳Wjw=ow0ϊt/hջmT0@*qBndCzL->?x@pZ ŊtWk#g~o 2Zo \Mr\VVÌxGZ6hj'j߹oIM=E ДaffE'"A?(S/uu2m #%* DϬ,}S%}٨X{ה;68(1v!\!%'v}og`A,gA䫧:l9ö}l 79sHXbpv@uӉ`(?EdWk \D6q; dXMwYoSU[I އ\@ ˼b\Xsٴ8ndaS"k] ,Yzz1JaLb <6،ڞ]\w}cZf֧j=u.5%ԯټҒ cQgyKl3篽?O?zk{~u ~y6`抂Ab!4[kqYaA ^́>o}ʊg_߻2b/~0%p"g@TA弞[v:Cն+:yRh? 4=h(A, BA-ry;XLoqU4qHQ7N6gb(fܸ*!l4jkYN#|z8`0 ~/zf`9mOXjjE1yo3T1aD;Swm>lf?w'BPSw.ǞF;j!&2V*U6Muum۞~/~Y"8g WʁuhVoN?lMY|;O__ZvFi2BTJkmHUwhvYso~ G:|┚|?<<0EgcԹբ)Yٻ}iq}=|÷FFn-H+++/L^n] \?}g.ne`3-" 'rK7^{gJIUIGʇU˵z7z O_~$(oz7^%4ŊوA.Oz$E;)Vu|VP_,FF\W% ɻk7ޠ#"\LcJ ۜ%X7 q-$7 i# ov͗HR0-QdW^,f#mm 7o oݺvٳoiE'o), -ʻ92򈚿민*<*^%ʕ˻rQz9gɹ+{C\=z'O=~̙':{^8wŋ> D5ה)΍ 3 5.0 {k0\u7>.DNu?BB\ mft]M1M?x+.F1dnZ4>SFФyƵ/K߼Sc纪 ҅4S\Wr=fX&[gKQò AЦ:[&Mo>uj;jo,gϕ ,!0Bz y7F+W󋩒5.$s?,&~N$Np*zƍbJgS&YרYJŶY8F }C3aBqC*d7^fd 7j~ 3jUB~&ddqEtG@X!ʆCtkW͟[~11Ggg]٪݊HW I64`_zkWeS߷v/`_xbs>ZN8 5 z5̞doKp>9sekSVARh%a-|V$nM(KOWlTlf9H?0'w~蛞%,IT 0YB2RY8>uI]ŧl FgLXIQe$Ȩna`JޑȨU13_UFiR˩FB"=/Рʟ6 Kc BU_\J7nEpCSNiJӝVnDb 8E_ӈ_4Z ghZ5W\і* YѠY>O&T6BPjz|fח׭]cYli[s`Ю" W_P6gr1O0|t<"_~|ru}kzV,[=>ev:SRRJGڀG~1M۳{ɢ՛WBq|^~U]ܱgeU5kTK Y29Sb\a&3>p:8o-?8zuu.XT̆yeU--m(I,+-+kXpᲁC6Z8ml6oشa}V˖.YPXqYڜ`NK+(CdYxsNR|| \ʁd oґAXᾟvl>s`#UHZҽ0+&WeT+-&,>eHضm0ÄL"_={׎[m[KZ]m]ջtQ#M\KJrL*abRNOlfaEB;ۻ{C[vٰ)uL~}5]M5EDV+iRlvr,<74"7mM7ۆ6oذwEW{sd^A~RvJÎ $4(]s*CAwxxxΝGۦ{hokiZR o^QA^nv*u<Յd+oN]_Ux=E۳g}{oZFVzkLs`ZI';3=59."Ge* 9#fy0?08U,HctJЁ}~[lC Z7uaG9+#-9)!>Xu!x&RC7E?CLL !?<)*&&66ʨk< Cߦս@vq{9VHRXsFy!V|\'$ QN]c)LQQTt32W׬qQy@ގG>TPrtEJB涒_,(B!䀬ۓ#)OMd2E  n-<q]vMmM5z;EF>`4鍦(^0 ]Z.8 Ee˾p"YgJDayazIoTy8N?~7Vi_ǨdQt.2jkMV"z\Lf6Q+<"3GSVg=ȱ#޹cB35ic2gT91I0/5_!m]*6rN0zF> dw.^È"#q4R;Q&rFf#$b4$DŽ/BRwd,,"rXFQ :zTy@$(NbձY::?3BO7ߘVH:T)lj㐾twx-|쀌Pg@Bg2H3/qbr9GltZ_( ~UϋUp9tCPy7m\-UYOj%/"!@G[/ZlgČ^Yy@>q6CBhɨ{I i*$"RP)ӳ/nKLD2fo#̰ERSc)d$^qC~dw~ȋNşV%Ugbgt 0[xIM;A|wr֮И|Me0k  (ɢȷKPYO>OTyl=Hy (XҘ}4v0ʢQX31*DųB͏={T#BC/JYX5aV5(X<#TkS>p`L2NVǰsDz7hcfUTUOݔdBMMJHHNTQ{<(^UT&w/JҔ06e2EEGGL,f(X.!15-===#!a)!{7yPN^.}IA^3BNN )Ѡ7@c{Q[ ƘĴh֞d2y0Eb_^--)WkΤIN3`豧\4-Ŋ3!..-#5c-rFʃyhag;Mר@1BbBBC+6R8xѲ2DQKD.^q5sȊ[Aa^NvVfzjQĩ1-cHQhLN˔P}ʨ(^X҅2RXbGɶ M)?4q/WTzʈ~y>q(.01o30>)!SNoT)r2)RSFp# 3H{謨;2Z"5X劧R_ZfBJWC͈Ҩi|XHSpoZ0&|o4)~"kzF_9X~'b|/ +=,xnW׫F/Њ |Uz724UeF)e9K,e]&^%}&^jŊ}~Rk,1w\ ֮?sA~HG;@/uSIT 1e nدccYg/73v(>lVTwN`^'Z,B+Lȟ]1kk??+''OQK:@E`ߺLK%==+_;/ R-4Whrݡ}XyM{SQ}v̟`LT_Ւ_2;܊K ztj4 FyWClM{F^/OE=8>,!uwp?p X\8GNSvŸSqɢhA@ogTrAFTr2Н1ꓮx>@-ݴ^F"~l@31:?!+4xEUoaqԿ6u!mhdˆ ?"-2p;oD:'OT3tHXgd*\>COF7e)&?؁@'YeҫnlaFULKXB(j8rR52.X(z)'?~vh 2D.P2c5JwA^C0=?<m<HgqIjg?O0'ulGQ֤~S!#V㝡: ?}XYQj ggdHi`A_GB*"=`ԼƶPRHBMDRvd{fnBl,' 3{x:_X# ) I' glx-Rۡg? -`/;8>s:*67ݧhՠu:h xћOpH76n(J2J!€[? ,ɫjA#+1c,.QC Ek}YpJ͜tM>Y ?=y V[u鉷B(:5 7);P5$X8R|n^" d6-<)ӷ4t%X3ëbNc A }pYV x5&_#T@" endstream endobj 18 0 obj <> stream xWMM4A@0 6&(mTUwH I~w3B3=]RAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA9/SW7v_G|~n;vvvv2! V J٩ʝ(nN77ZtgnsD" ['ӓSOŸ|vppYO<ߋnNO)ԮSn1~qIw>~*=<:xpP!L=[c%Q#QX@w5t =׳oW߮on:[:Wm>_>A>Hd==UH#<'(MVM?/]EZgrZyKNsciu*Kl`,IoT7//}zW`FDb cn:?>u{O/\Ǘ|}=@XG/} ȹ}{nJ'վGJ! ġ%(' r7iW卭J; exE1ҼFKsh8#l%s7[:~'$@ȼmswNy qo?z_?_@T,zF"ҫj 3 xsGVt^]zVGx"P,-WpB: <8Vb%BHcs1 _z';c*+Ȉ}a5 tIg1}1k>MѕIs@qAJߏ X@LΗ0w <͉Dޝ QD rupx,o]h{΂~ހ=3;wk 31+X("ɔң&Sk(k%VCYZbqUWg??Z(5cF*5{Oyb "ăB^VtS!|@G7V_ϱ0pW{FX@Y@t5Hx$8Ԅy8b{FC);;Čb(d#!T}ro5}נ0Ѵ2Xwp&)7p}j!=sG݃B|MŰ|K k2#PEK=O8.+C+NG8 lJ>*D(2h,t4;iX+DAgWf?->r;4<2'fj4vSsBi^by Xx>Ha1=|Q_(^]K.L!5nR𞁤0%ӭ;@BŦ!#Qbϕ|"KA:L^ {{ vĕ8| !f.BM ['p!d®n|*C G֖gո%HQ B YxEC$`-D0_mV#DKAd\(kgxQLp8iT G5 I!'A&goBBL?P]e+zݕswWp GC$t(5Q/*C!4xǰii_bpm<$y2? z@Q؃/0΢ee?mQ<cOAUs;8^`Ŏgay=F P6vSREՇpбŝFwaѯn:<7<<t'Dn1aSAbpKO?84,@ԧg3 c ԘP*zܱqRFɆ@:1:ځfڷE BѡB n FH}ise<嘽`Zŵ'N_4 i'6yP%>!6,9$pKAW(|lqr)PՏ{閉u6}Ol %a#ȳvƋ?sߔ3nuᷛπ$g_o[}7/+jG"Y&SkCՈ:riT&u{^BBf;ᖽ,LN !| _X2w3;+Qx, VƵk ݇Dx6;b@b3u>9_fV>& {5!H$.$iAG2%6{Y<sUחoZ2g%{KQ8%Z|ݞk\W|Bu?]O˥CQ :\7Qp}3aBYf::t-Hc&,=KdMdX pdYm,+94,ȫw^f871T 1AeV1ly(-W #tH閤*O?x~˪O[Ļp^呚׸oW*#*뽔Z3PrKuqf3c0Ró QLQe[,9pfD"xʴʼ:%IE}Ӛ { ~lĴɘݏ> ߱Ig T\v-rj89J NѻF&֣ Z >)Dlf.ᝨtz4[__z0w.4VL3~HČMq!&xezs7dx;< 0{VIO{.^< "&Z 3U [&.{ֲE'imhC>R.׋ZSݽzjwcnp|u>W &$=+ Tw;>sap +mpQ߬( eZ֞H)xX䫶 a bl&M;9tÍGcm)n? 8?GžL׷Đa Z%v-tH5ǝ`RЈB=^4rvzӘs0LW @|݃# G)/'~ڼNHqt?1A]s "YF]Й9KMޚj=$']jeҺdP69mf?k;z=GRq Ze1Q9i*ۀ"Baz~ֳlî7~!܆vy1ѼvǷl,~ȇklm`~˱'Wէj-ϟEkC vOlkB.>HY}?um2hbƇe!`rl_߱.*26Hk<D%64"A)~+bkzhɟEvsJg-@2rޏe} b j0jp8"ۛJM{?Vׇ.>`C6avVږ|XKDB-w dLLQ*!3S;aɇ7~>Snm{8Ew2wŗ)ygH_=,`\M7:!ͭZ~zlղKx.ɝxhN ַo(iz?AF3pPgqL&BފeLX[ef;bG6|9YBџty 5?k~{Cіv巛te{۾JxS@ǿ' @[j׷kVN,45YVt;t-(s;3kiln5:&g=KV !YB^yO~3ޅDib眡䴚At(G!($<<ۉB 홴dii<ďxcNulml6I\y~-ZIm=yZGq R$$P_"v B=37W*痈A?lQlmpeX "9j)Vl@ot%FU߯ +E '{Sw洐2k4ROQtcWlijj%cHT 4%x_C->/ꦍ'[oZ0"_G Zh/£p3Ŧ|;A"BMiw-Jz/aw)hم۠.{KXAυHCD7 51c7JK_ͼea) (C"^ܤNeAhe"y A 2*i!xL|A0B e -(9k=DY OT[[Eؗŷ+(7O@k"w ţpL^c;Սv4'/ ) g.Bu}vW7NQulctyu,Q/յZi#lP`o1l, Idzcm+}MR[[ќ~`#,&39JX7yywy9] މ9:O4vl-ݮh(]UԿ}j                                                    t" endstream endobj 19 0 obj <> stream xiWL$̳"((" VD0}Sfaw9kswuUu?`0 `0 `0 `0 `0 `0  A$$AB 4IIe ZQ2 E~7h()j@ MJa_P  ?AIbmɠ/AJjÚźcX-kz"Q2vռn*bjWhhZ74Lb.]ĵc:ӎص6)Qh[#e nνVZ@SR4lݧ.>8-+*O)Ugk:/ cضjL@#/ُÍggU9՚힫H=+@wTm5(f5%(β=a!G6Ð2U=_^vgޒɷLev.Zhrw̾ۯg=yxzZr\8(8^d㷾h4m:O?Lpdl$=fVћl\j<4_ReNUJ^u}mh>;o hG#eFc2ԭ{˨huen!o.A8t{l7 T*S-GlFJm~Tn4\Ztr $a:[(5J.UC+£f&btvM-CA`;3_l̢\G@u TU^>d! ]XIf.lנ1CV'Ux.Q}ds] +>1 #is\v.#@7o dپJ9V@n:NhR6N_m3oec# En*L/?٦j X4kezER٬,yu7[:KA|vA=ql(}/M_ՂلJy wY}&W>Z!,Z[AҥAnZ˰0qIyNxz A$ fU8N Hǵ?.6'#)% ;KΓf4;^9@f&,I_nNM?sS%$sЀTn]eU72n銂'bPj[(;x>4kTl9B e6^ Vg>Ԁ8>ǔ~9uF3˱qaAåZ8գxE!dG>mn6Aq6VMTZ.𱩳sP_%½H]8cuŔ~A'OVZM.,S((|ogVK_x&G S>@n>E-\7iY%W/VrfQ!]qs^DX6l]t"g.rRa@OxgV=Rwwv͏J}$dk/42Y<LzVWxþw&(\3q2JG#NCѠk|,`QA~.$N3 lC w1u>XrN,$֡ۆxj/t|.ZDkJb?OЙK]H?l{\=ؑ\z˄P4,Jh0k )&@A+@Oj@Pj;=`[m %TF6ɦ_Of ^/B Nk'6K C !&cJQE'Fϧo jT/zm0l!4`a53f 4H31 (كErc 7r?x0k>CѶvl; e+{耯jĭ?A6ʽA=2,Z C Z !ٮh9Z@A)M_Π_Ma% <_ |HH4Vt c'.rˁPf}\2Gg჊_--'bw-?,cE 6_U~(G@0t:*(ׅɿ>lMd>T랇|^.IǥWeW? )_ٽyV6r8Ώ fW̕Qm:uevG-_q&h W^=)78^k=OEA~$VԜ"rFq; p_u3$˗*HPx^vmm;:|+{g(.7=  0za(#T 61~e-=,2Y T6bZ/ۧ\t¿9 $/A;ZH?PNO9*ͿZg^RU_.% @)-0xмw$AdsֻE[݉WwD!}$0ðd8TC/5}XrM$`s1zVO2`~^n#i%RV0`Q)ALjg6?SyD?O5tMXd ﺭ&7(CV&adWbKԛRe!=n4*$r0@~/R!|޹Lj5<8WS!z;$})2S)TN]WRtE^ -,)7EkLO;֭I,fR,)Z,ΠroD+{؅3YY~%y[g[ RQZ{ 0h5qZ·THilL{@>t5fF$s_˝wE3X9x(v_Z: Lwwu*) 'VB*oa^Fu0fƾԓ8("?V7˹CH I-t@z HPXC,Py!O:NIz͎/Kk3$ TgGbu G]t=.9qڵLnJ寱Bww]cJ,Ias]wvdLJ nϼBJtZaxId=MFLwQL53 =v6~:YIo?~A=H `0 `0 `0 `0 `0 `0 `0 `0 p1 endstream endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> stream JFIFZExifMM*JQQ!Q!C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((+_!#mkULM }; #'S)(.N<5xch^ s^*-t -J9$ĊYڱG`clV1u#G'uѻzSMڲI,nH c|%1R=J>ϷLC$2TJTҬ5?׶æ3ӏ# y/|'w᫄f-u`vSS zQ[Q@Q@Q@Q@Q@Q@'d5,U@W Ttv"1Ɂ@8eg%O;Tzׇ:75rlL~>ۊuJFƣ W."ZXh"˧s[[cG݅qG\}~U!mp;~P@`MNs6qI1i1pz۟|=ii7uwqAV;ޢdSp'})h\6=J(#.,A׃G'#ZяWG\r yvqjXX2 }>#֨!\\M HR)Ms߸8K{4WP6DC$}qSMK[έ3!\y$ 6ئG^o^jAy%-ql<TG%}3]wPk)ݭŠ(B(fԾ(𕟈>]u]ʢ@n$R9^0-k9l U..>fõ3֣ue'OHgYhrP"r k6;I}hKY|y ӧԔeRReqO:\$dUF2zd~uП36j_(+ ~Z{ygx.!ᣑJA7 ёEQE? ($i$t>dc?5n)xd(',I.=* RwrW:6aT2@G,j$\:*-Ҕvd`GN*9=ͭvSvg u-M8Io_M(0r}xG%g"Q^ͪe՘OiΜ;cwՈVEHQE5W]9x$Ycp3}}gkɮfVdEP,I r55{]{ui3%HI0Ux'x_ц#:h: 0d ~8DZɍLSiwp_SiZėgǯ\zВTԃXQEDt> <] Lw1H0*+_ʓVcW֚W4vծunT_Ƭlcsρ#\"ez͐BD|nN2i)FE)uY|FAwI1jAd.=i$-%+mCS8uaAg.$8kteW&Q.1Oi f,i}+njPGKNvA]x{$2o {;˓#9f$rrsj $}~XVN (((֝: 9?v A|{_j;1-@% ݿg ʕ|;L7N9^F B~0rW=G+U#kJ=Hfg͔V<7s¬\\~xïN2RWG8J[Q<ûӏj+K[zxfHHsq927ǰ+MgNn5(zE5Y7SC,;|cyomb{;R#Ӡ&K%s)=:y(X~3Yfy2Hܖcj>S P=k)J?w'9 5BΗQlvs}~Ջje>c}ZUt p f|r_ju^:Ne;u#[IS. 0ҡߨ> S%QL((CÚhʚ]]T{+L)fEIY6ccJe!\[?wcO\YkR6dr軛ORpH}[TZwC,z@{ Xfl߬n^KזrYK{V*f܌c"{e23Z`;WqU(?SXߚ1oj'(.sDvyT}MDg"AbNH>.ұelȥ98?cNvi!PYF@q@saNņ )`pOoQSM2EU(((4QgGм%r=~wyV0k|+0n/%|9/HEm8oir9&9ɠ,'BiH3@[=M0)ҀT. 2Y]z%b{(rRۃIt/by( {Scv9%OCNOJIց-#ML!q֊b+E((ϖc$cs7v7 6RK ITڧFr3k/Až2>Fzn5 UԓfXtۓ) 8jjO5HiȨM0j&Q}@h8YPV03ީ3\4xe>$U9?tkX蚦zuĹ%ҺK8IÖQ*rXqOѦo*(IFY=M{~_RdT$O'x{HU`` e'$<}VAm0ӓC*Fפ r/5%Ы*l Qn81j#$=F1xZ9W1޳ C5>D+> stream x}hUe;VV LOP+ 5R4FaEQ+$U`(A&PRXS+ŘΏ}xvny>/q|{{ys4dcᆽ뫯Z0C?Ɍ(7KL6)*oF̈́`>L/5M;0~FD2FrkEr*w+X!KA%OWD\rI;tDH,pa" YXy{3_Bn7~h&{F&}ͬC-K,X6R#*I U}9&/K4wtu0 xܔl&f M#xS=bj;hTC 50yI.yfy2f8 gd*Ctc" ⵋ:Hc: .@'v? #[8ƶ%_r]+lj??/`4f7qOI}c \1v_\91&Ʒ|rn#K7 `*`ldI͞"ƑU,lx N3wʃh7۸İ~#k?!tѲI1RX{R-OOUsݪIf8m3|-;Uq_N[d"fi,ߦ4;n\6yOl#>EbN޷ q%ͼq"NgHpj+Bcjc5(Vp6rD o`<9rL!2~ DoF@o4dڍɏl>Qo$4dg?~c 2ZW,:# |#!lbnL7Co\4F}$mڈld֚ xc-!R1ے]<iUv@lNE]ՒC3/`K@~2v!S  \Dg@6#w<Ҍ-9}o"դ#$ʧʭx hV ܙx\#B/M:.#%-+sOֻY7f-dJ$:,R-Kn m#2F=\ Λ5r̴jVmzHdsesت_/LJ])F{:n]':!0#tcEtycAM^ӽ##H|OLl<Ocs%i.5Ƀy[B F*5ߋDYi F܅l[+dDqyֻC gw쁹1;'eIHY#q\^/h]7Y $$% F SI{62&$ (Q-5$zQ}A4R=FB`Td(HQ"f)xa"/I]f{ <FbVy"W˺20`<"> F μ21wfᕁB<АsO{Ǧ/(e$;hFi}4[AgDdT`C 9#hlQ!F4 cg`ů #˸.F uH} endstream endobj 24 0 obj <> endobj 25 0 obj <> endobj 26 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222r" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?Nq@봢n&~6)- w,9OM\^0i}ey8&TSDdzD.s>_ym`i"qY7 SExFdl#rqk.5 ZqL NֵIe30szU uc*6Fݝ/fc n±lXvnR_%ƫ)b&5=U Ү$519[n+x額9}-vp^tpj].ѳ VS)J(Ҧ/ܒ(JZlrBOI#=UFI=QޣUp-rz׎-tY ,g9lIh%[/yվ8N!Jh(̌F1 94Tc<ߚG[I;{˛b 2jP%DV5^0:$s' |}3^.ַAp8VAʰ![ѻa??CYb!h[J579lmK#'<`; =%^4VN @X?66sJWI+3թJWHg-5r _|7y.aRTJ-ϐXq3nFzwcQs]{3jw*Z|j $6#߉-,D09`qV{,v `A+u+;ro N0O? jV:;:/\'\kl ,q$ taľkʊr5~];D 8涣+KQ]g Yma=j0PXgY|T݂2Ge-S.;lM~,|qc֤ρVn<!P0@ uWDQ03 )d&Yfhv¯ 1ԓ= 1Lh0h\iRS@.J1ު3ɕ 垙ƴD68\JYWDx#E A}j'Io*} IQ&( v$UUuَ>vMYũ.}ݘ<6{ٷ@m|+jW70e,B{ӓ"<.7~G^dN#}bH;۞?ZC#P1V Jxcuձn(pi ۜ*ʫ쑹 X ѣKT?Uly^Hw=8u^|Q#i,Px\O♭nĚnw$azND7*#&{}k:'tہ}q_>h;#ĭ.꽾A#Hn-T (ֳ\&7(ΖqH 4Jr bxTč]yBƻEiWa+tO_M\[K1mIU[B+`00=Eqn׎!__j²4]]Z%ͼ/#%!Wg M{5ڽuva `1BOZ[wmGPOrƏ*R[ک{-B.! w5foF4۳(TosqDQG"p Bc 1YF~Tٿmr%ֲnj}H#)Hdm͒JV[Elsy&N96z3xšoln:U;)9-DJ%6׮ylI,0 {U/)[ח{<:̷.Nz5C Y\HXAkM9}KԃJɝgxlVcxOVfڌJ:kI6Ìdzv띆h t'od-`F#=Nsa%Jgvؤi~_4Ɍ8UU1G\mnI"W?/Vͬ2}8TjZghz .}j0m|eH29~qi^$B>@JWx(ݖ<qVKC2{וZNQQžW$R~[p~e7>Osl~ FdO_iÖ{[mq% ӡܜKJj.Fz޳|^e:Մg\F9YS՗#}+EVm$KtsyH=w]2 ]  Qʿ7 ;c#$ӯc"WJ͹zGR/䵤"Hn;zTyIBXn_ˑCF0+?kiGsH8c0-8:MjGq,LbYz*Jxqg+C1nV hkXhPjB+8D# (fx-`_<;y {9ڼÓ^{/5ēL*)U">y?gcO*a'#7)!.!sH pJE7q7MRADjs+}}N"kYPV$8FTtT9 #Uc$n X:>^ŇjKM[K27'ҼUʸRI톮ZEۡF9+=UWyr_pz鵸0_T<IOr*-^?w0?Ŏ).VM5ΉgԴY Xt܌pzrg41%GϷLck?W5B08֨#l =+R6f\LJG998ǵNJdpx}xzn{}+?Po,1 $Hz9j7{SJ]i-خrad>6Tp"*_VQrKѝF=Wxa*w3QqXntp_4wdLvgB2y::k+{u֩k=: KuAsǦM}1j--`@D8{(u/s̓<IES7qXx?+>i3ES_O4hCImչ5)e]\ȡpO#Uv'{j&9\[J=p :TR[IXM1x<5ǓNe"@":s 뇋QB5 :H0OЎ*z|岌A q˓\ƸjoLJ-KC8F#ްKC%ս/2K , /nHV\,cngݐ5(q:w!n ?ƧۛI;⴮RkmBoʟ~V"%&1>֦&w[ma ${WEs0$-8VGѬjv~3LGF>g(-M{t:.;'Q%Fdž5iZzm.bٰK` kWIVE?1^kZSjrGҲEyӚ*N)LL-`V'A̒\QŲ^ݤB#y[T8ט-w˩=4*O'Kn.<jd: ֋TN4#X[`g1[-=SV#>$WF\5[b_A%+9}i?9۱ .kk#sQHhVfV+eɏ (孍{BQ17'0(QiU"Y'A\Xhu60&c&Lqۡןks(-nQn)Û6'V*e.;>e֓m-Νi4$ "A! Ƕ1bQErGgT4|ͩH露gb`'_E|,/CB5?v[M"/<+:(? endstream endobj 27 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222k" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ? p p1KE0 QKQ@!-4p(a*ySCgɨD@zBz H5sU5]X~n2#}4О;#5@+c*Vhଝbv;=3iV}7c}+Mh@5tl['+cªl}J9}l V붨Jhj[tچn>) j)Ԁ3DQb9ǧ7H@;gѥ(Lޥe L2R-&+-[圫=u-Gƚ.6uww BI=}5GMjTX:Iå H[3^ᾯSlVחN_;{>U8SY7D͞¯ [ƺ&{Žu.kv} ʨ7̿QRcGTQE} -y.M8^O-O\zYtLh\NgՍYP\:yJ({d,'GQe`U5Z Ak:#r|!h|ɪMtcNÌ׶W'(q"8]irI=5_[n=Y5\yԚ\F<ǎE?Ekkm  =3W%.'Ͷ<$q#{O@ y*Tu+T a(^3?*]k:~Tu_ 5v;3P2,{y<1-׺upvN~kᾷ{x;{a;]2Akԯ o0H*Tv̿hxò$[r& Gbk.7ix@Hy>zKe_ [sy'숛+sҳsrOykk2Ŭ;!&8"+Ğ2Ok|ȴSjrFqzW1]SX',ăTG`UfJA<{ZE9dpW0R}67%؅e$ɷiu²IדGZ).|PGZ>+?lmiB2^)٤I5ӽb''t$/.!8&DI8ޙ׊~ee`co<`ni{ԗ9Sk/iҕyESoܼ<[`3sB^]gg%6(2L4 B--L0x'ܒOE #?F.-~p-5s:WI psJ3LpÑQ<¤h 1V,8wĭ[@Ss+ϵC57 p)To-2#eVq*e+ &yh$pYˌ uk7)x5,hU 3zֺzono&FR ^=Hd1[$g8l==V}¾C! dpp1]B8kW ;WixxP'8_& v?zQgv3RcGwaEƟ=r}[wɢxXV#0K:noh(w=Kw?dxVFfib`܎]fI/F=sOFN}7 >'iY=S [{G{__nfMJ8->摨1Xj2\\,uqYNrRFQ}O :צ*{'!!`$nתM3'?*/u o;IOԃVdfP쬋v^%,yv[Y"#s$hV7!N;>>sR\\N\M$;I4#օ͵(I0.?R?*v#?wvvX1^S[fޫw֦.k"v 2|V[^Nld!RX iL' U$ [jڡeBJ%HFT`¨ȳ[qt"xmA)UD,y\ʙg&3ܰ*CC;8l[phՁ,qkwqyl45i~agK H8aU@? ^ bzS&"l{pHeU^ 0x? ` L7ւE-AC+BZy>sϽxC2ͨxVO*Q:|71<{)[yh%0R8 Z]\g< ]GP}BAyd{'#.yyQp~tRմ+m~Oi~W7l9pka( < 'oZAm~:.\x0]'?kDFfNY'䬝^-l&ՙ֓5a[9`qĚvzlnXے c]jzj I#WƼVĖMK2pk+e?wjT̯4dCrf[ztk(㶲Tڨts:VJtS~֍23TNM2HX_RGR@=:ԟ>a6oZZT}ūؖBz5~|2šΡOyprOO}k<ЫGv혱,ѩbz6wluMh$yv$vX X$ c=h@k~isP)84Nz'ZrT@TYX}j3 lʓhZ) endstream endobj 28 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222y" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?*JZC@S)$⣩;TtztW#=jZjOߙu:?Zm9o5+~soh s&&F5]sH2 NLɫgԡiHw<֟ްYueBsP.*c9t`$|t漲3 |g8G{8hghPA݆=s5%eb {z +$~$#<9:f>:sk:v-ɉZPӹ3TDJנRqoghfI=9$q o"5[x@& eDe Ja':u2HiX49[XDTxڌHW',>ˤ&P}Z=f,ͥIa=FqIR5-Oarʢx܇*r6eUtεzRI҅I'OºcO7I>Giuy#\%JΉ@ckTjGiN1\ǀ5߬ Wl.AָψmM aBѰ$v>kx#9U{Q8M){?R y.$ f:\ׯ`Nݤ{ϖ5Ff~O~;6_XߺII$ vs{ucі |(d We,p *? x^;c"+ԬaKXi)NݐѶ c(3]z: Q7#zZֵG[DfVku8S: -;C miO${H/u㿦+?~]S_̓/>Znp{ sF[hڈ١f+]"wǭ'*.Nik81ɥ,2n'kXKW_5WɕgbЅM$uܒ>mD !|.=75g\@\6c}*ppOb?^mZ=3a\gDW^>W7ϊnV}>yY T&?8W~CX3`'ku"߂q/HйGK3^w|ۈOiL?hgjeԧ_.HpXs\5=t VRF\'8]z:ı~$.>wY*[VjC*YWdLeYyzPU"'sIsݻ[*dOQT91gR\- 7/r #;F?xten|N_pbd&x?)'}IV=7q~\פp.Jh7V͸GuE:?jZe~\y W򯣼On5¶XWR#n`'˼M Y= r5}]5ۛpCXcWZG#Ү $s+p Χzͼ섲J L=v!hv99E%˯\՞ Xg{ie\z? MJ%F9I1.Wij)_G8G ^0xv:?%GpɀؖO͚#0$M)ӮA?4 i}(+lӽU>y|?H竔R&G>no59Or$c@P+}Gzڌz^Xlb:dr? KR]'Oo,p&[ w^V>qQ0m$zuLJrOҼrk:K8OA>);$sA 2;clj[Ft(5{ȸrLwzg<',0mE\ޘ<❨_eXiWJY.۝<Z  U-#)+%]W |W|S$" H^yKkO!칄 ,{=t&௘&|2C2?C쭣+\k=5xsrɦI1Aa}IoSuc鏭Z.śuvmhcWH.AepD9yn y% ;+3l<5wxĮ{ɖ!X 祟 I?)} & C7ź|3y0rWj+y$9$=z wɒ\֯v٩ǿ.[,L;ǭ 1\TRgkcw 䵛D+1CᛥWh =uNֲ y3.'m&SR+gsW?+s|g,O?M< \l_:l9+昦hyc{[-=,lq|jMha9b6קFKSqwxSf. Ӣ#mbx4$I?5 a̧IWw[6EBd0OBym9,&8裓ƯnПGer<3t2L]CS( +FWy0F'Wev' ŏOVo_ը5I3íuӏ,1٬8#Re=Vte[۽#??zZFSW{ڭ qol~u/!aċ\#N)sYK6f=WҸ_I>e2yRy6{ϠDC#@҅l߹H;ϵfƚ<<;߄mnxNݟEx=ſ)Sv 0ൔE'%7W鞵ȏ~ ]C%H"f 򓎽኎VZh[W  ֝6ڥ^'':x"jR:RN*xƞ"ѿ̱y&npGY ^ .T0F:4ki );Ź9? ׋x7A+e+yK4,Ts~5 iDu=~,5Rkg?m۲@Zhjhiaa0'=}7h& 95vY96:}k'(*8^V%>`?|ׇ6'.EGMkmZe-tKkYX- x%zbx>!Vfd\nFDx䑇X@W^?_P~]+Yfa d8=ÿ|3FmOOvy=UA޷l?ՏմYJ놱F2ZT{ -bܔk1Yu`ȑ[*F0kG )#ȱ[7xk'/ Acd# vditUY\ x"+h9i#Pe\'^'~ O5]*_/ָҹۆZe7 3ZB1bIN|*Z_? Emzv0V3խr]]];¶V_Mmt``b q8U/7ſ3K &X^IZ,WZ*owM,LLWa?jjSV95'ۗUSf] endstream endobj 29 0 obj <> stream x흇v"ɲE,д2XIso{;" +#9g՚QCQY'\AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQ(,= ShZ RomN?mEyV7!'YښK܎ d(7SGAG {{zl}h~n6nޔXNݠ诣Ên4joAz[Q.RmklJ~/5GAiL$JB.C:1}t||zvz~q~ququ}qus~y}vqyrv>>䓮3|䇰`wwL/?'VT)EZcjQE5bm%ZKi5K<[-7nFS{GG'\ԈQ⦴R#ͯۻSz:~?p@ z<WX@C~E*"-ȱk,Z׷w7%>u:ƖJD8l-$<|䌖Heuq d[ROЈD7{kv܀}z~ &J:3!%3EW/ݮ͇cmH %[Xw0/m 􆴨7|7 ؈NQTknniw"=݁~Dt !7+aF&ʥ#fdgfQ9FpT%jQΜr/~ (Lq<r9*Z(X>j:ԊmO82x Qb?U+H\xg" vReXD>_2XrCYNJ$! EhZJG(.s;aYT ˌ;7xvsw0!az`Sn[:EKaɠh)wV^ց*ao<4b.2QP} ŅFz7s w(@=#O]S1:9.h1 R@03BZ[>Y%b ř9p+s҅DžL"{+=d3U%F+^Rsoh!́pG?~a'31. *QP(s (0_^Ea?PekAy")$N<8ʹn?{ ͯDl9z/=}Hlm;;՞Ub OI[橛mO,-q:S n fNhxhu]t$F\8<226w>r2?_l-{UAA!vy>01 47A<\gÝI `cĶ"_Ņ?WC}>=41sOZb("YÃt~c;^&Vuˋ ƹfqiA"$JCNicV*,x$Z\?GGx̕ϦhK [+H5q89⣙ʳsߓjP,쬸!O [~MJQSr |BT*Pe1V +:8?j q&V𥖮6-:|2)A5 \>?M~q#`)=>y~,ܤ!BHާ@$_Y%V)ÕU ]ML>ۘkz՞3̗F枞_GVv$-.|J8.et^0}UUs4G-"9T)Ge,loP~z{;7%3\@s!Bk)bLM),h".|Z$oBy2\) 2R'uWx.E~NS2,E%*0(dɜ-0(=5=q"qp>f /oc1OVY,mP61p&kl 9/<^cᶋ"z򑊌O_\y6LЉ4)9E99[>$ꐣK"t%;3vuv$.|^6}}<YhtgqXӰT+>c!nL6f˧V/3)w>ąϋa{μ5t$.|:˗؄X3W) jy7.$YoN/$mu  L>jiWfz0 0d6Лks;p >RDwԝ`Ilb?Iqs!k;Jzr`Q_МT N%Bh\xk˱}%ڃyGuL0 W6j6Ar=ٳ Pv [b[) 'F }g3+.| xy߶a }|.$a89Er=rk:l9ML27e[wst6ŭlGf>y9Yhq'g0T-aFZqp|2'2& M9Y*` Įy3/5o4Tą룂8ɱR"gè'VEmsybiܼ :YlaKq>8,Dx bw_Z|H7- `͕hc+-?e˫[y(.25F@laὓֵMlA"awZ!c9oXP2(A^n , ~{wcDCąZ/٩mj]ל'Oږ9OVZwa/l_Cpq" .V𶏛7Ó{X:`Ռv,+b8 y%"<p) z|ą3ƈгF;ڬ3Z ejp!6N ES+Mrv1"=alŁgP!L(D\h(Њa/8}tҰݵCӶm9J.KU#pRw-$> 5=O`h=  [ֻpN?Jdכo#BmćLvpo8o Bl0<ǔQf%P\P8A~6Foyɼrը^X`!Zy$ q` #"iD]"dԪ1y`JGk]_bPƈMqpaJ]y!s .|Svpހ@>mio?r)+<+?/}rl?㗟~XDHya]M#-ݿ!b_;o@4ގFcg"]qv %/#\VRE h{λz;?ЎsB`8{L& VE 9l9gٲ-bO\S+&Y+Put#ns>!;?"^iWG~w`5AHKǏx#&Rl=c(9LaG>E|ssf]^#LjB6.V-[/1tAbcDzG&W.Qxi\7|7?u_*"-KHn_,{uȑJ.Te#͑\ÁOE1(€Aa6-Ƨ4)1QcWoi:ӭҬڭo2v pת^xsʹTR i}"oVb%cK}Bbe5'ϧ}git`_Zp LZSmk?f}+|U{]H@SW[]$WΛ/HGX\kNDV"-Xuonqs$7$aSb85|{K^KYk -:ް{?~n`K+} q8#҈sE5,Sڲo"dpN7CeĒv&G$r)n7Y+sCN0 >4YqZ?)t,}|m}KN^G%> stream xC*9^DҬ("** ҥ m &2w!7&_NNNN2~!@ @ @ @ @ @7p QH"+ TL+hj(IDB~C #X"S|k55MEJektحFB,!+4-z"rh;`sJ&"տN2dҫ$#DM}tvĮ'㆘gTpDeqGx4r~o+E@Rg"ћޖVNd J4ֽ@Щ\'_2RR.~WGL8v80_ݿf rTȾ$.vR>ۜHitCG\@wK-\緷9!RټbjwiaNOE<&p~A9_ڝ.Mwm3x5Rc\ov5ۡ*] ۇtjQg pRHd?]pN-{s`Q .Rzt:4SfĐ.6=j1kĥ/z:F7cH~FBn <[&hPfo<5NvS6vR>/ך41#տ#oU iX]tȅAtj}ßnmnՊc*~kb{3 @˂A}O"Xb{,0 C.6j]̿<=<>]gj/|T\^4 uj}<e3lԸ/w9%μN%>(RahRk(CR: z`4Ujr«M'&霁lLg5x(2aӢT7:ܹ5„*uͱT6mDJܴY1^48{-_omNV̻'wy B ۧ2'\:ZH@vEoC-R""BRл"&I29\b:y\'sb!w<:p \\B BR^LL%Xn7 d"d}$1"A@sߖ~[Gl8n|80FpgC鳵v{.Z mA*,':x<p-VoStd}i~Phh7Z/vW9AGzdCKr8B;sfz tzJ: uw>VXBٞYg=ym HI/W ;Lla6 SӥS1P haiūI%;t)id2j L(2n SMu ;|/Zң%KI}O JѝIP$ˋCNN rUj NsZIZ0 &CX/Z@qPD8A)&pԭ|\bSDOd8s=HVm{@x=U:#j5t2;j п@/6NQhM5P8c`3(ҁ(+3=8s=}<6]D-ʸĶpt7QO{p$=r ]fCx3ϭ)<90YU[9dZjB"LɆ, ) BAӂ @K y;0\?S['ZG 0R=4pcEo%8`.)&U2QBj | Z`i3 Z̴ȧw"Qo~7ػKWA}ѣLf^BH 5-wc4,MP,S9^tasw4ÁoUXG w_nfݟL13M @n 6X oiݫR'qjh`р}rn=Z>?~`BVΰT±1^<~4\ZdNK..igVޘtaE~t4zo m[I35|*&u84UV.::i$GM4% ͻdxh9J;lW!tE ]O*rdf8I $恋, XqS=XOSH(tf̕kuO~rek-in | 8sЮ\ ~@3L#ꞿ +) r#O,U5P`!8C/.x Rb~LQ%h~+}s[ R n¿Ť_6?@IVi²"vr/٢7f%)2x[x|rKj e,7|t:2E ΫJK3ۛF0ܰϔkT ƸEJsa}Vӓkcõܝw=7I^,3wK-y=e_bAM3 XBV5w׍#`Ro2w]{vLxRkCp(pqZ6_PIigUk{NBiu[fS r &'HR7Ym6IQJ9HXCg1aoФRX$usk~̓#@ @ @ @ @ @ @ @ b- endstream endobj 31 0 obj <> endobj 38 0 obj <> stream xXn7u]V|? H0l]8]FHCRQᐼ{yIOb$!%HJAJtƥ"I3 i%4)GFAe'iA.I|-/q1c 1=ZmI;lF-FWj8 A;Z91 6 ['*Wϑ`h!*D8YABHGzM% Z(E` fk0ҒCW@oC9 H2|'c(|@ !'`+RPj4!p DIZ0B.!" f䐉@2r#H/@9*BtApQɐء ?u!b dELՂtwd^@׳@tv6;olX=^ 8؛7/_h~f_74?6>5?5C3oM! mzt0hq&/"{Э0-Ss\5ms k 9\(.fN@r4\7ߧ?;w.FONVo;ɱ糨uݗe& ^Uӫbb1qLӼv|aP%Vi, ],)af1]4z*q5Oyvh=Ji>ŗ]iO0F8?805T]"Pt5fOWU9F[]c< iі>rX f >j>]>WB;nbTW\9"{s0ǕZ/l"xȟP1GZ[R}x cvGp%m]D OGp-_\.~I O$'¥df$X5c-kMtWvھUY-Yxv;\'˲Jy%)GX^WvǔP.R[HS1//]1.Au!e Z<_EWѱs✎q; ozcI|$B8>eڲ|u}?NEfv-|6EF4{r}m͎zYWYw5wugr1_vgm0 ,!2W?c~?;4> stream x| |Tյ:sIy$d3y 7J @aL$g&@PVEjVꣵzڗ-JVVH~{s0ag}^[kϙ Ҍ~}مv-||nW- ,5̻)d&ҷܳ#HYئ CDDߵv{mYo$絮K?[|G-Q z)21޵lCQ{5qDPp]X:` | :7v&HfCi yh;S\+ \$CՇ.+uP瞧?JK!/!y B?^ղ IC77qj" 3|{hpbRbq4EptIG & PBnΉOq? EUh4ZQ#Ch=^ʎ/D o _nB궱F+P6ǸWq:KDVs]{kBYO.&!ޤtڮ uQ& Қa9u(Qf 6%et}-ݧK㰌,cFu23޿*wzh'U'4HɕP[Xc\[dnk?s8HɟQp<S~T@B*QpMSqTB%R*QRU+XEU4XMՉjhji2:'>M)4x. FӀizotA33i&|:?͢Y:Φ948&ޥy48BZ\D 8^HӅzZ -zRZle\NH+Ml&EԜx.t RZxVѥմ  [%'jV`ڀvP;:oQ:Q.vњěM]FKԛx;ˁ1Q:Z \OWІJ^Eh3m~6?O^MnGJV൴ x]xui;!{"}%"F&e);\ A7w-nIJ.mt++ot;.x7 JLt/p7*ݟ8BnUCaz5z(}>B_~&=-=JoE=o%^1opx^~}$~|J~DIO>GO } cS qqQ(~r~ГޠtF l_?8%-iOs~֎dmSL'Qy1}a^L2/1yIn81ix1hyѧMh'ku2KE?[^M5^d4nz F!IA%KZ*V8ӏ\e^ )1IbfHgKPcw6dm QwRl68/F9-:9<[^Y?%/LhMMCÉS /i#i,ATgHnM)5-LdMb͋$ߖ݌O_*YfnŊsԔF,;I%6}N'os,AӜ#Y n?ݲ'y2yxpKhp{f,r`niKPYtq&d=` sB`;Q-Ce}gA,UL2 R;)BQ꣯ӁcB"JC4  W7zŇ{ GO^{z'" T-Ab󀐸fW]Z:@B$VDS ~iqMfi}~vilۣBh{seM=3)er\fHLp+Y(뛖4\gF]s/sils3z5ύLEgtO@(Kih3#{5o.{6oߞP`R@ 30$g6k~\M% fCSs)㼘> dx)Tⴊ "H0)x.Vl[)ܢJI}OEb $3"oZţu;dmR~gS<X4I,>giT$t/ZAx V.WN8^2S*V攟(;,`1\QJJ$N+ǿqMm]<0|„Yy \ 񧥲2 E{y؂U61VS>L[w e}<P7\Fqe ^9&9s(Ł$@wP:m(PDً Jʙ:zQ4+ieb]Q0Q/DTZ<~#czr5mO7\2y% s?zXj"p 3Pܘ 4k1 هS̬kЮ\G-6ISkmCGn;ۄl#~kҏf :Q֣\r+C((?ByMPl+gLBC[hX4sbxn1<[ -sbxn1!B*O[hqvG\tC\yz-m-C߿{7oBm.7PCĢa5NM$//I \[͉kvJfhwh:Gm -o0z? ycd<5Wt|p2?.R"15Lf8Â}piGGUG5q-M;J"r8xDa!CM/`‹rQ`$i쇤,2#_|̊r}v:|#dH@<1DLGήd\)*~2YgG2RPۭ:[uhn/n/nn/nա\Q:t!|]E҈ҁe.Q<<(/>s!C]ڟ[.?fhֲ__ #>=e-"Kg-ij6qyy9%VgG/.Z0%0/g9?i^Φ%+wV{/j[OgF-I}OT W谟^0)Yq +xEkȑCM Bcc;%X kZaM+i5ִšVX kZaM+iKXU8s!KXUr`1<_u|%Uȇ5a|X3̇5a|X3̇5a|kÚf>?T\̅0<}n%'8xɀ[mj<˾f^}= KR Y9- 64ך47Ov_MS$_xkiW/[qUoj*gF#ƸO[~U|CΛ6%l0 T T @ @ @ @ @ 0 @ `j3,0^?M.I6{͟pIu"_eù~aS&MFU?؜Rf{gt,b- vfAe cWYu0'jsO3u"|+gf&a&a&a&a&a°&a7mϱ 'xW]g͔ӥLEiGqm\zD)!lD5]Ħ>_͖~M& #{)irX&k` ^CzUF/8S/8S/8S/8S/8Ba/8¹p./<ԫz aCKY``_3/X;jMoW5y_3V/XPUW#KOzn,tz+Wp͕_-aV+6ŦOyC2Hb${um-AF<$;*O09 lPPP:쀕\GѶQ-RDdƥVm0-+-7jٻFwA==+y y{-2N͉$Du":dHN$Y'I։$Du":dHNdj\jvgjj_j_j_Li|04>`Li|`L}}}\H v=ƻ8e^i^|MsI JKߟɾl7ow:i{ZM45j^U3#9n99SI:5S.ثˤ|vd;U  ۩}BWl5U٭➾Ei]WR~:G6c-Ļt3D^?ޞw]{U'_W^M :r#e*[D{{{"̅(ȣ."nŽ4ҳ} <Kf24sp3U޼Lјgž?ᛗ60kшwpCRz o :vbzD3wP;j))Xz\q#A #d f@/gv4`8x]Iњs?d'mBkǺݺVmӧ=g}N?Cpˇ|^b0?qXű.=ׁ8.؝8G:ܕ^VqM|؝xzXyY"xFy8c}iKyr^onE`~bcmbīyrN7U|*>n $Xű6+dI-گVqK"<%ı;XH惭T[p\ۗCϩy,e#o[r7zR1yz!حEJ]K)nBJ]Nn 9nD|;M)2SvRO*폕z}_W>ms=E&L=rJ]Cx.R~Rע.zו~TVUJ4oX"mRO6J=MؚR)EHo4 [ʊR@/#]6iQߚ`lT!jnօP,]jDz҅(I­.R3$5_$- Ƚ%ҊP4He wKbA\ۡBo=ڃ~- w@rGݍL`4\Wd+}'_()u0+e"1pLp(&A`4ׅ["lo$ꉇBk+tHp$)R8.:#}]mR,. RkñpKWHe7m 2t׆x[W(E#lp0*uݑ~9H+)f1p705c]КvE"kZn&Uqc'؛7NFo[Bz"q=Ym`hDBh#sx0"fGJP3&<%:%G#}h˦yƃ-`'.&b1ٹK.+-U"=/b<0ZbWKET1=ŲJ,X/YJpPw0O+(Py(PN)/_n])T./ Zx,*D;Y%{*m0+'J@9͢R?E)ǦNV$k L*J^H PZQY6f!يu| 3^!hBB7Z%<7-B=+T39!)wKfw5?ݐh1}wRM[K݁Qٜ'10zɳry! õ+A~.UV):WP5MY#6PamJ >`lzI8clF` 653{٘cnrn9iH=|#vCnTUς\pme)'ʍ~ ?.<3%><泣r{eZg[o1df5ҋZ[49;Zo+ZtQϞ¼1yl2b8Z;2[ofVXxO+W[g8ʹ9+Au8ȼ1..DÝ\V46ڏWp;qdEU[?_[ q>S->jp?quQٌC|ݟV0wMW?-@HF(RJ( s hk!teWeiJxT2 <!Jc܇+0ŚdY+<,3%cwVccքws~m~Nw~I<n)VkG1aVwG%aMEUּGX.aM̒*ڕjkWǵՆ:[^r[FԹѢL)N1b8tu_ۢ{ڶ:Jeu<^ϥ[shbZ^=܎hj1YmYzXu#'`՗NOS^ғ'JS-KoQJk#8VHwh+Y9?ZŮ7'O}jr}-NLNd~[~]2U?te$h+>p"k='NǖdkgK Rmt=~޴Ey1)kt)٤/7r|./K9H^jG{@bz916Nد~DAkӟmm U\~߼> 遏zJRARiԾ؀)SV JU iS{}uS]B6I#%M}ǥr+zY z*U9*XaljD. 5P `;f?{^z8ľ 4Bx(x8;v>ߧ-!u[[2:Dm76ݨ5e¨F0Q%& (`&^*Wa UxjM6jM6jM60֚XkbmkD*nk Y+VRͨԌJͨԌJ*{[NlU4XU lڡ ڵonb{lmvW X[dKpj˱q}ՂX^@ˉu9nwbb)Xm3,,BB[c ql!-ı m2Cβ9vXXh,SPM_("Mx͑d5ؚ:]d0jiйBxLˎg!< QC.jE !̶k<˶<ͧ-}~ Y ?|FPWAj^[5,wje#uIJX:bYb! XB(BG]ԣztQ.E=G]ԣztɻ쿉G | IS)oHY`%WhBk<pu7/C߳냲Ii󁐪5^&7t P`=lP 2 $Ƨo֎L-.tB QG637i4q8}< p ZA;s +]Ҏϑ䉚-0|lP3|=&[S<^ X;zL}jK6/mgؔX3wETeGPz֍Vw"=Nc&qVZa6}ACn8 GeM8 ^8>xއC},^5A&e0(YMFePETuqA{t<;-h9IDO#B~"sxHDHh$ "A?U6Qٌ9(lpN\a(Ga? Q؏~EE/*zQы^Tb#A*FP0`#(A1?yQ+ZTJf'TrJ&*qq2bF:X <3uvPN*өckYqlYc74sTzՃ(D Q7!=(APLJ:>u|(D Q A}x >> e}xCză'c~;{uW{uWǎ?v,pt*q a{\߼K.q/';8DE$*|AºĻz+!6)|9IߒY}T OfSv %LȗIJ&̐gd&~$s2O@"yA^5ere*8]+oHT:Y/dldHle]wG>/Ki9"Jxx#9.'$ |*AbyVIX.J+g2W%"פM9;d- endstream endobj 117 0 obj <> stream x}Mn0>" $ABH)M$QI@!TeIӨUk 7o8FIK3,l8#"IFB͇Nșy04IYNtHlNtV۳04&UEchlFsi|+' L`:uRnUܻUPyc;ԩS1+Ol(* .50[i#0ۢl5RGoٯ< zy]ll;eq"m.Ήq# "OE*=j'| endstream endobj 118 0 obj <> stream x{ x[ՙ9wEv[-ז7Iv=vlyc;Y싓$@H K%,!KJ$tJ;3{-oJ>b]$'N[D=?~ %G sf<|{ _A^!{Wg/\ܶ$H$[+ܿ"37=FF[ D pMObȆv.#$`>8kH6 36޲Ax#Ɵ C_ ,^u\i=%=a[>Z 4otڑc 0m#{Ƹ4mOY ٴ؎]'o&{`[gȏxy\ýFֱ/'/$M}; cW5@D39#.#!gC 9m kς@*ڥ&Bx\dpFrQ($3H*9 4?Y2\6 <ο@z-d9$* G`i yABvv  y_G_&?EŃkhr]s{ev\> 3Oi`a5ǰx j0WӠʗjr 8X/)=S!-dӔ,Zf'$.F{BRDrb RIf(RKH=XᙬoV v; iZi%} `%b.K b=+kyer:8s>w\E%jB~ k\.dw vOf23KU:;~?79d>bUV+ Q-ua}bQM.jΏ$ry󋓐]?AC8\:Р?>00džx= Αu|4uxSo 7ŏ}ixWwᡡ!o sAnK%mKs0ᶸk}.!+εqڹf#6R.a!y'M8 sCq:`mC4|ZOiK8WԦ ϦOd?!:wŲ#ڽWŇ/{͆߹&98msRxU8n0:NIۡWCИ>o #m?P70rS(n,?۟|*y:q Vȡ|qCq{!; JXH4iAuG@jY#X/.uQydP֔E P>-k-dupX-mRšC'Pl+ew9pWx(ŝ:tt!t!hE(A+`wewZuj|`5Akօ>S,׍Hpt_屸dx9)ϧgCsA \yfg$^_T|C'8b lh3sjjP_W[-+),mf(Oxr<*pTRO8 FA;IˆW}h4a𛼽Q :=) bk DuBE4 #!N /PWE9,X\ljr յj<i9 sJõ`ݛ!xu9 %9k+]%yVk^9,(viFW0*ǖ 4ܛo,*/,jlK1k~]om|cG~4Y& }13!WG `eq8kx7?bu1(YBqRXAG6<";(HTPk yK\'OʢhwO˲IZù.#DZH/tuTK~d -ňG ))OtyEA `t|VgA[}Odֻ<}S02l,9_9<GQQrQ}<" ~Q_j86l:8AO"% ycW_\TqIP(`U F @$i%[ rA(c!4* HTbY LREt[# X_ᨺbj s ~IPH Q,t ̊Uh& t_@ԕG5`U4sCOj\)q_ɂ (`bkX^XҵviFGL74h8+/=;:^b7s莖>ü<Yk9:~`T}kcÌʊHЛccң.jҨ )x|dA\YDD\"YWFuSzmR)TuBNƼ/VQn^ƩO袸1;ym@5.'v4˭+8{Y>3rg.X{Co7wĥ0sKW=|pa֢3w=aݗ&M0ysb+fw+GaWX&wcf3˒n2+뺑n_"/84 ,zelZ(UPĽ*<2-:*CG~hw{zG`^i^#(!˕.N|hTOo"XV$\Zd۲44Tr]"~# TT7`1Ɓ@*k ˄Nf(p9N@Ih-,sSkSd&ɊRW2 涱c/nm-- U#{Go<{Q Hn}bίݕSV}Cm+9 bj)Q ZҀL7X2XP/hsթ6D,|5~9V4uq<{kFr[t9?Tݖ;fw^ w_oŏuwձUn˙_.Nu\,k뺡lmO#m~jcG BA$C8H`lB- hOE f@ T@fQbJfnY:z!˥"DNk YP >^i\J9nX_%7OwX )eU퍶*,&`'V`ukR! Q5AxVWtMLeW4]l{ZݡYʼnS髮)ҶmnYͭ;J׮z~oWwl\0\c^'ڷmiAэ4B9,vo2 H7I"lZ0;%-݇YgF2Հ NB"ֹ$e5FV/ER!,$A Lrqcމ5پ{ߡ o[3Q`O)i͚EmN.l; vnرPalyP˗ANo](AZ "Ј٪"p.F!2U&((&mҢ%HZbCd/h2٪-@[!UijY}>9~n濡'>j1جy%=kbyh{^۰7h% 7z{/n]h(-Ӟϵ?]p?CLf7]d>LO73Li$!$&O o$OL|e}]]olOonoFOxK= YNNN:IOPS*"A)E6IJjxI<RKܡ@ l 4^r3! .<?,?(|<>w)sٜ)IFٚ}$AR̓zBՎj=p*138 (^W[QzDQ8Iv'PkZ*慷&v'swއId^Q敡 Ŭi HM:ށx1.D=7Uc[. vr֔8Upq7:Spl ~[ ~^ˎRRW(rkl@_ CYƦ{+SY ԋ,_XY3:(ȡ\ܒ p1SCG' AuY8iǰAcyrxȠOq,osuLǥp|c]˩t(Y1g` ksc6҉76lx 'NPQԻwyOw=oڭZ]ܺ"|Yۉ={{~ܹ}`,BrV e{~IxsmSY$-穚v;yivYQ@9IE` ,c;;1W9 ,94m g lB^ƽGr ss$KC/!dxn}6؝%)Hpi練;RO"̍ %|z&K,q2a^%TމuJnjb4.j ¹FeCMQLRwIX-^K%%sL,ksu]{Aȭoiz~ϯ7v4Cpc_mNRPZ 7ͯh/ -;v_" ;[.ٿn{.>_dx@@DN8mbrFt?"ҬJ]98䇷lVw9fY\JcdjRg#JuBr0N#戬$S.(3 %NIȞfwiG!~jk_{yor g񗐣b/?jN$eW>} ^ǔnTc✦v:#B=`r*sGWL)+P@%L`6S h,i(|9z&(D&1q E5M`˅W(\:[%Xb 騚)8.E-H.5h28`Jtۤz@!⭩~ǜG/gC㰆 7`A~zlT tdtbPe7u(Co~tcL > RJh4*/QYPP$tGLi `@ q%R=gUA=0 `¨\i8$~=]=6>-#1$%I,J_bI>Qc1${oꙍmGk[Z+6ѿM,$:[o}et'ԔYUPlڱN@inn?P≏rv,*q㓿\+M/]]-N qJ%̈́[^&Ժ2}G,ᅔx,|_q  -8 -'H"DLEwдH"H="W;=8ϱHR%Tޅީ*j$bdZ Z[o9yȺڦNmX*1H/#mⅉ }a؅:V$\m~}eLCIb`~n Qj+YUqtcEu p.CaEĀ,ju,vn}ιe}:ZѶw>s<·gԬ;2*_gmunx~PEEVuu:tJNDTE,})`1HXZTq&S0 Lg OӔ E"%̨b3XM}@5AYPq:Ek묐HN.e8sW> 3G/h.u]A]oi࢟500w@_ IfŲE\4ݩvN:E1Vʣ+ٰ(MўT\$Ip\>ׇt-aJʙ;s Or&VqvwtUX]cun߹+.h[-v4Z;|du1hw捽J9&!՟I~^a2( +J-B*SHfV3D]}J(씒TlA+ cuVIAEp#5SRG424p%˱/tRh-QNai}c=9c3EzkhQgL阳f}++Ccv`'AO4d%ϣdy+Wtǚ@; i 90N#5V3q"QLƠDQf<"oRD^9 q)gAˉ$& $" TF FA1 IA`gEE1 8RvU 崁r$T;ZըaFom*lWAnfcLP;^^zayUV߻aaPYM3fzw%U>ѭ7/ܶ)u%#*,L`W >G{"RUvʞ[G.d;yɎX! 7y06dQsrrN?7u|r0\-~U_8#e q=O9P.b܅ g4@3`*֔ HkCD)>YNR0(w(1D0 hVC$+:*))`T"-`;ʬS_`[ixGsHtsֆskVPVspH@uv՚W|iy3{D&IX79n8ό+"i+Ws( #4{F@k&p:z@Ls*aq8,kn;5iv,(`m/lN%MNz2O`YOaFcUar;z*©qlWks̐ 8{{w8c;XXoQQ pΙs=7_83绯~5.[vdKE0j),瓵#dGzǤ,X"gzXFESNWIwU$u_JŔdpOG_Zyn:N ]VE.iTB =Uuj61ڰ*je ca$^}X1ﯨ >gk3fC gӌ dwJg(o4%#j L;E) vDmZTki_4&C.D?aR,Ɔ. UԦA'9 btvG|HԑS^zT>L+B%.|n"az #Wޓ:e`O,*fDCu^*9K|}9Ƌ_D?X?eq_-7Amܟu6Ց,h8^{t_*iIiƗF~M{GM#F%y8Q;Q7sL3$ ӏP vë&/=:kqsHO*C,Cȳ9e3'ұѹ#9!*_ȒFαEH 4ϋEnGJ-;.N>8/3.v-ˡbGbQa^N Oƣ6h5; b51yn)Ѡ 9ms!42.4nȵ;&Jׯ^=oZA?Ҧ 7i4Ex =` 0xjyr-/-0XLs\C1#'۰u1q#'νkÉODxˍ˄j3R^'WAyo||1﷼S7Z_yjvyBtFJɦv =qQZ P/0ڦ#$&eȚMܳϚ# jkzw{Mgϫ>6?)"|v%ܤ(dZ/~cr:9ďsT5%nO?7c=*GGDk{K_ sKuDim/<9;1:3yup{)Uw3LCQ ?=4}0Ip6ug~Czf~ş~s![S\)6:bֶỸ{S52, tlַbp4vЎ«REY |i`6/JSDbS7-=XNhҴ'P#/  ~EA Z(Œ&M 0 1)p NL7`2Gx[?dnoҿ)!u]*w7ΉϕLegkmW %\ø3~wPo/I|wdJ_[&"<׈f2|)A瞢x2dQ/hF,SI3F%ZETLR6X`>kvD4Q E~ˎWw1Oh}oqqq[#"¶F7-Qg,g,CFѐ55SioXz)se?_ hLQԓQ>1bccy+^0JH5 #4LXm4JrʜVQ>qnxׂNFYD!+iL}6 9Ae+o3-V+zQJ.x-SπcjgZt̹)j&iՏs><3s><3sMbƴT=Z/DL+NwNg=z>e@ȹ4Y)4#>RZcjg@-]V.aZrxӠOpx%R[ s'bڇ3I$i6c백u:ll6c백u:ll6c백u:ll6c백u:ll6E j~4(yLLJ'KNtvΡcv1cJ?A󙖩δrЕi*|i)&]Kw>EvPd2H{OA111s>Ӡ2SEԂnbڏ υBs!\|.d>29b/9b/K8/K8/\ ]׮kWUpr̥s)\1r̥s)\ h;Jh׏@1-ChevL;vVq*NUũ8UTUSUq*GUGUGUGU{{GUGUGUGUGUGUGUGUGUGUGUA1S?S?Mt?O7Mۮۮۮۮۮۮۮۮ[[[[[[[cvq.18f}3q}7J_4׃6zgrЃOjFq5eGv)H\"[k%Y/}R $EFȵAI W*O-ܠH|)k]FY+9q58RCSTHOjQ4zdfI([qwy]ΠD}NAmƵNEqʫ=rWkCrY"pkH29ң 6(zBlzNVu{k\CQ;aU7z<[믓k_`IE8#'4$noAKKpHf I[IJs3Ml4&rZvFxY]-d.I=š'G-s1ivps H'SX 9 QJ9w*Gz/䟫9ӟzWUGciYys;AJ(3k0RqLCV U~ưS׌i sgÓ#z"D?Iw"^NHIXx:ïɿ=ɔq)ǤY;{-2ǵ;2tk`镉9?dT>iWZaڳJ_09mSd?\@~3"s\o5|̫k,'M{+"V,s>؋vE;{юh^c/|{Yi?Nhe. [d{t:)@:Pq]jx6弁wT3(U Y}UU=UQTMTI}J\i'QiPi)A{FYn4!n3M oFx+x<ہXbX/$ BbX/$ {|2oAáp8wz8N~'xSm心.>Bv~x%z5[|E— p{#)!@QƠ5m <}6WnyZ xh/?@\?Cp@;G(3\/_~Q@,@x: O#=y~2-A~1S ڂjW>$ ?|\.*p&h6or \GKGEKOC@[A[A[ASASϱ|T+h]}}IhЏG<<<<<<<ao :Qp8Ҽ{µe.W|dbx$4%⚊zNwS&@My8y7T 8X[ozɍ둯 _'t"?f|'Oی v{;›!Rx!_KUze<\a9F"/lyxwU[9`< l^ڐu7 Ғ_yGn(p 8@{E=sE&{G^p_5h>NՄ!}k5jVKW7ґ'ёБϑ\%?Gs;GsO fP?Gsz&t% )UC_/VHR}TA_/UЗ*KW·P@;8to'Gn\ǀ ~ w6F T"[yT5ZP ]B׬е:fաu:hjV#a~>ęyGL^CLĕ1#h6/"`' "-y!0pǀ ]\G| \2J79=jXjTn|'Z%Zm.[p$l-u6K ɛsogyk1}ϣX ^}ճ=J|[y"g^.!| ׻%2p?;hkh+hkhjJ܁@ Z x  x.(${'{'{s6y$s,#@7p8N~i=s7=w{pO[^axN{cfwN6>Tid@%vҎZQK;jiGM2Pd ']޶WaMw lf50r?7#}a{i}8wOg;tܷc]_ 7|lAOy9I䤀-q rTPԬnAZPL*(UA JUP-g 8Pjx{?a_>q?|r;p[İE?e0oJAr&o$1w jC[BB b==xX<M(s]̇6-Q!ebxR<%x_N"69M#H=nZn}BΛXcb6Xe^b/e1 endstream endobj 119 0 obj [ 0[ 532] 3[ 193] 9[ 703] 16[ 347] 18[ 373 580 580 580 580 580 580 580 580] 28[ 580] 36[ 680 647 685 753 581] 43[ 756 307] 47[ 514 920 756 798 611] 53[ 644 530 590 730 680 1019] 61[ 624] 68[ 507 559 467 559 524 337 511 556 256] 79[ 256 821 556 556 552] 85[ 403 434 373 556 512] 92[ 512 462] 114[ 397] 164[ 507] 170[ 524 524] 229[ 556] 232[ 212] ] endobj 120 0 obj [ 193 0 0 0 0 0 703 0 0 0 0 0 0 347 0 373 580 580 580 580 580 580 580 580 0 580 0 0 0 0 0 0 0 680 647 685 753 581 0 0 756 307 0 0 514 920 756 798 611 0 644 530 590 730 680 1019 0 0 624 0 0 0 0 0 0 507 559 467 559 524 337 511 556 256 0 0 256 821 556 556 552 0 403 434 373 556 512 0 0 512 462 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 397 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 507 0 0 0 0 0 524 524] endobj 121 0 obj [ 507 507 507] endobj 122 0 obj <> stream x||TU9N$3d&0I !@2CL (F@(wte2.`]uuuE]WWQ슐|Ϲ9}w_?9S{ 2KCj˪*Le,[6smeLV>vR[͘r۸ϼ.Ud޸iS62݂+جqUB-Z?omX\͌ͽSVzvQEh_`sQ3u+X&x/l=;avƲ[|ZlX w:#}Y-Wz3~/x0ߺ/a!7lSQi{7jöS қ-n7mKWq%|򦶄}RkEY01׆{g8qm7,Ą=^z|jd SX7~`{eYk=MxX@}0^xy}81RcQetSLn鯺5 et?7v/݇_)ez[KԢE7jnټZ/S ٹt.a gO\,?nRPR3SgӀ@fT/Ͽg>%&ܿr-+߰A 6_Q.jQ[E-jQZԢE-jQϱ3E-jQZԢE-jQZԢE-jQZԢE-jQZԢ#x`8o{G3 {n(jQZԢE-jQZԢE-jF?`_ZӘXe}`65,ve{<zk5vo=߱{yZd?+򮤟rfj/r#D/ ;^?U-#yqb> |˗-],lnj_09k3fL6uI'TWQ^V:vLd F(.>0`ހܜ,_wJncLF^* (UzB9!]o46q>t|y߾OEѯNfЗ[>gހNzg֖V *|3h+mslUUriQεF;MgES gO fW39{fuXJiؚ,U0м HxDB4 V޵+XZ3g>E9ڋ4t(' K3JFJc93ED&Y'0@L*R s?pcm]3&ڥ4#R%=z5GF]оD° SZ=)4FD_,Fkk  F|ı"vqbYSE]j8Ksա?>n (7Nq:uٕ 58A ŠH (Q |&T/^TW{rM}xQ~MGo|p[Šo<.$$=o!C{ g>fyu9M̮H&R-P@4_-EgkjZjKmYУ^SAV ~c]lTNi%#CٕuQ} <"Y$%nȭw[}y{b\pPYMDZӱXa 4_ì9U 7OT&t*Ss;&QpQq|Q ]Ų-{iH-fGhɖ \C{$W;S+}#|U'PE:|,ġioTcڎqEmL[M%ĹS[ՔOz]8`O3:)F6[u-pSq055D}E sut:Bڹ@a4cW)m~_]B7tVfG*,7%&^<:}^3w C0*EhK]B P)R5h dtDo;xߥ~*lZEfT"yb?$!S Ϙ]-*+1* )3#ˣկU]r<7$rmwh s~|1Uʓ"6+RdAOoD5_ ~ aCY锷P`&VM8>g hVz}y7E<ʦ1)|t8Sv)ΐbX+R4)NbHJRbmR,bhd)Nb-R,Y&)h^:)jX |)I1W9R̖Fj)NbA)fJQ% )K1MRLb()*/8)*(LR)J1F%R)FI1RRKQ$p)IQ(P)H1XARH/@) _R"WRH-E>)H#[L)2H%ERH,EN)H"^ v)lRI+U f)b0Ia ^ \ Gn)IqP8 R|/wR|+7R|-WR|)Rs)>bJc)>oR|(_@xOR+_xGoI )^5)(ūR"R$ŋR )9)) R<%œRGTvM]@eDDc)o PD'#FPb"DÈ DCD |T/h?Q?\tQ6E#CM{#K.rMgޤ"DON#ѫ|e^"/!D=K |I'vJ>NLj%z&z=@t?..*y%h'юpR (N$ MtѝDwm']8 NFt+Bt3MD%mDScQ+]CyW]Et%TrJ]Ft)%w1(B 'Jt< myrw+l97w>8"Xt{']LIGO-p\tr=Rmi4-NMKSH UR %ϓu ~+X=ɓ:ؒ&ϬиxP6Vw/6۩䛙=3n&ɝ !.q~!eb3&L١* L2bs;9?F; DJY[CUau۶5CBHU+Ձ]~|]ٸcS6tSģ'N ^au*&bk6fq[`eE XJJ+k;8b_EI+?4רh J\yZ;70~?9@6>n )@28D q@,`,L0z@7OP0! #p ||>>| | +>x 6g-MOkWW=s3''ǁǀGG]@pp/pN   l~  \\\ \\ \\ \\\\ \\ 8  tg[YqL;8sq9?8sq9?8|98bG 1#p8bG 1#p8bG 1#p8bG 1#pq9?8gs}q9>8t[/݁_+z]̄,3^XGi$g3.fX=u%na{?0Xi̪ ,=oq<#{>;Y=.C<3kuc9O.=DZmj|a[l6ya-̜ZbDK-ABRj)kl;?m+")LKbs*;al]ZE-}*9mДdldYX-lvqSV\v|vG.E7Ke 싫5x/W3"Rxה}=awٽ\6`hF4ks؆9XncՇgk=.oU<QZu;f&.H.{VqMZK ueZ*ԍФtounҿe7jJ2yn݆;݁#"ݩ\u0vb%e.Ç=쐇٣4GzwHRz= {=^`O G{>ԋe {B>{Qcc1װl2k4dzY:5@ށUßؗ)̬{%=ߪsԷt9#jP_FSl <ØN/-w_ay;K[q;/9Ρ=_翽/8}uW 1-VT-ZQ?ZP[[HJ?mO pס!1N1 >¾9Æ 8[zȠL%JzJ|ިl{՜Q3ѠMcLl-ёLʈ73㡷qXk0rnIz٤ ̔#l v%H2ܲ6;EN'uh2쎞?f{Mz^;m[Po; ޿Xa#5j5n4Qʜ".h  5l%%96?e@;w;Y ,>1߫};+G C8 *e6R4E˖K8U8*V/SIC8LHoJt&{LJHtf&ZqܔIM$Z<Y)1|osR\ 4ը&/1h6`<쿥5-uD ' gn6~XI!~!+WָZZZmQ10_m`^8t CՃOo11++;:X ni5ymUofozd8٠ſ̾瀾 +b'{1}byy}E6%YԌƌ{E.X̽tbc˕;v rݒ&c'9oTrc+c'5oIiub`k_zsjVbPWd9O;4Ty:GKv̇z c F1#Yqd;3х\192ZD*"~u/5m)#HY1Z)5}T}GOXcGjrrRk19]^Ye*3t}&ZYs 2 ' re{5f΂K=epjY_=d<ȩX8fv qZo?|j{HO%#U,"Avx :P=]T#&?l4F9`NVXtqJ0vMO~j$nk,+;[S&ĉ;[ʘqcw_!= IɎH w9Zw&f*b"ŽrNy'hԍc;{2ue%SCg蛊iVO5ycg6+/U,X+bʫNU6PpV9l+9HE'"ſij@bnNOȱ9=N1u؎"|iY_+hn=R261^22GN#hPnU 1&SrF3pOQa7fQʰT'e:bbbL' ?2YL:&%b8M51q.eB6[J8&^M ũ1jn(i૭+=R%-%hrCIˬn FCxkÆ+kR$!n9i1 J5솳sf u۬s**Xcu_rJ_B7ɨ㺗)qFAoI ҉))V8wnIg2%3{Gl@ރޫhit4=YD=CFqI7:Kw\_ >djR[cX\~7/bIq~_>~n".')ÜJ{wCgW^ "lݫ}ա?K63e7p!!+8&)+#='9&&9'=#+) czzГ7bI雑j6UUgՕ3>`mV]--fGj?cʻGC%Y5d]c:,ٺ,ɒOhf$=fF/mL&I6(1 ,!,돏lGXKCWG#YvL~%*UzիɓU$Ehz'v{lBz{jz;b]E"6m/뙱 Mms`z̽< ETcv)61봧e'׃C/]'tldјyfFP̝K^X Bc6ު0nZ53әPh5>a0gpa~;G+ SZ:ԹԵfLQTw?ʮw:?SWWVf? Ȣ J< t<\`d+6il)訪ESQTJ{%ݽnk6Su4ǂK|+ʵ X4dn.[}YfSlo*FjɲHShSwsn4/lfқ8 -U-WeQk]3.}FKgD'{fAۻ+.=v,Z1Xoi?ڽZ#^mRJm12sZđf[_l>ŤK9SԎCx,4^L7\e iCW؟lP Zb S8x-LRiLdoafY]js&(J=vˣeyI5NL;1o:_b>Yp|$)nJ}4Q)ucź&wwe^U5bK޲֙_[2jROwK~:(WeN̵e .[,&K3_ 3g =9D=v|.@xz}h`}qNze{rݽ{vqSQ7a`K2r1D.FFl?>~F7Fp)y qQ|be^դluU'qi,cYPaX5}^ e7:J:oW WA_ɨOUVC4$VS !!ʥ 4 V n怸Bo5X ƢiMe}~ciev,2tzo)tybn1gZ c͚a)=wNӑ5'Lf)gչWW6po![ʺ@'tDԀեe7\j.9|<$/0qWymn-k.^h늿Yfiw%z¥Jͬer^]?>ص=v[$xx%?t.)Z1CӦYN1GߋkSg?(hFa}ZIr"V^1:jZSk٪`V1*iqXWS%èT3, `1ζ@+B(4e\D0*B:Kҷd`+[͖'L|zeB4O!sW7JKw]l]ɛny]k-ض2{׾p?;ކ۾{xvJr;ăJJ٥:mvkˣ: +q \!LcI&1BG%d OF=i͵uB0(`KA1E_r0<&0ѐP*^ Ek&5V&}&МpUU2 Yls}huXj[ [F4ҔcKϱfÝKJ:)h`7Lv4/u^V[]h)0Z|Qda\=3WU1Jf)fW lǦL:}N_O:p|^<ow2o> |RkxRN\DtiXr x1A߄  wf i~- 5WIIƒ_nwCP)&@Y*S483e񭡒{vaCVɢ՛rՋj ȡx}󥭫ftx2xs{ḄRFVag1L^g0s\;Sֱr =5H9CIjXTyzXT9\/G=!AZZK( \_:m/a^M8q̘i ^z"tQJSbA%gJ*u^1@ 4mL΢B_|*;{X#lVM4xp)?~nVŽ*Fg&$)a\Tv|cfvU 9j=D RH~!d#_? Mq PgɮZi[/YѰvK>>V^= QYrF`s`@Q HBO*99P>nj_X);4JZq}m=IgN=5s"Ki]8ƌAvy <~IؿzgܢUUxWfYy^ZVySIESIU~5ÇY#nfm!r3clVN桓pbNdo1! Qj{1%S6X4rVV>.ӂ3)5`5Qn% z bP:P,πX446~!W&{@6yz~r S-ڵ"ZʉcXTޡ(?kMxY&~D.KN|ԚV&}D.Y dFd3WFir@Qb3L~X3,+4i:5+;UOp2O'_δBcLB3a.ZBv#o:N'H rm߰;<{v =;N=hs.k=sËkx7}9v=[6ԝkS,djZ.Hrޞ% PJ* uG@5x kؕZbh>ͤ=ȵݭ3ތL+iD>nU5kSǮI}$Z#yY.)SaR.f ߨn)6XxAڪ47-^3̍YLБegfu򆬺 kECZsK ;mi lٌVn gd9]`/!4If5\߸l}}ffƦe3-5jf- JjfkY} ekv}k7/)jַu4wyU`c:)ߏ'ߨ͖ 8N>^OaOe٥Ҟ-V ~őnQpJq .].%𤑵Z^sٳլSaEJ* үtv-|naʢY*3o7tWgJVoe~=ϔmmE leVs9]uY\Wۚ(K{$}}$ӱZ[aMW(!6p2s6n7Ü)3Yf\O$hB y, 8%A{JH|!;[5{}Ar62"ٵ ;ūR9gdyǔDV (WM˟WqOM˯ߛ5:S~:- W̷^1bLi9jiڟʩ,ʩʩʩ|-ٜJJJJJJJJJ4sZk>d'ɖ 5̗R9S9S9S9S9S9S9S9S9% 84I9sɼمK>d\://䴞zNI9%(;PFdMز [7-=,e$Xh&IJP,Jp%yPD^H>6 ,&AAp@ 8$~FCPE[Eڪh[nJq~A(Q(ꂎ~˰)8I3#!%vjC A?$c*"ctCA_"b(DDD)CP3 mPS#8e k'KߥB&w!ׂ΄^;qQH9)qֶ!0-p_s7ٚ(0&d}K=_KAQ?ښzn$1Aa&w;0 B[V0:e\R$+_emE\/u9@+9qӇH{ْ̼r)LjH:a,nAÇko#|3ūxQP"'c1P F+Ce&[fH iW1. Fu=K8i!iyW;2,τiqqzw>ꨆBzV&yY,h1$5|6ڥ6Y ov'IawWI 'yW9j̉%E{ ^"vHWi_!싆E;K~,UD=qqJ!xWEBC;[@>qzŽveM^3o2^ٶP΃tK:!$χknLj$ꙣsZtt?;qKrM&gJ$I=I$+6 R,~qK296,-YL 멾tZM^Q&4S}zR?ӎj0KA3$ |Il oJ<"G xSۊv!\#U&|&3Ŕ\1qϼz`hb1.̢OH[+iƧ]`6!~k&)^y!ZjסV[kF`'ܯBxw+ڢd "epm(G#Ԭ{Z^QP3D& A=TڰGI[ŧnh ۣ[ܙEԍ:-6Av tؿ,HۉchXQs8V_|BmDk<9*7_#\Arrxڇ+Dp6H{Q{͢hnrTq4TTMP $6Uw|J[F\ hĻ>}mكzb3RqĽ iAS+I?jdY$2GVEK_u7՛J-ܼ(_Pwp,<H8¡R =xѭ~_?]o{Ϸ{|0<pd{rJ~.,t=`doa] co$ `0yG C|,<y*'B>>=b>AAch B}qO +mÏAA+? |4 B !4Vʷ!'>FCޘz@^Oʔet,Dب? 1hAփ8?7B|$c alX()/0ƏzByT/Jz`,@j"hqjb@À!yx0u' =ᱠ'zz"jҊ)G=>'MaxV{0P+myb`E~y4X}Y/썕JP G=eA3J 1'6jX$ ghl;?.J"`ڸ8`H4O@⇫菎qhnp;JrGPM8*h~ƝH}Gޑ$ơ@ߟ>O)  "Z,_рWpHC@Qz9ACI_x< {|STX<Qä4#`dF!. '#@'}<,zb k8D_J[/) G]P^/Ɣb0/ApHN)~Fռ9 c&*J' *86h䇢8 c:]EB Qx0PK~vyb7 BV(i )-N-+FD>f8K)^z }ӶJ=$#tXW?*$2JK`e0𘟆p$ D+*LxR4QUHX4_b(ʲK6Nz!m'-pN!i,x(6B׃AIhv3Dj 󭵙jp4m|wOW[Ss_B'?ڵwgZwwWu695=ͽ|W um:ˀ 6h_O;jku44­{Y[{[Z'IlF|qu^ 7Am-=KsGsg,P7 noǮܫA{mO>*5deBW0vw[orw7#W҃dtX_c_[W'FcWg_:a=} ցf'i i: fj~EޯmmRdR}c@z h'GR>H}&\rOj KHX7 SWWNM1@Ì\+^]+шo^+DklFk?- d%TCz~4`"d=sdVImR/{,pm4$~+)/&_ڛo_n_kE*֩$ /joNA \ڻ$,w^ o헧?? ˀ1wZ ;p}hATbTӧ _TRv+m I0*K{Qɏ9"r+l:tA|Rx%*kdDŝ]TjF!ȷBV5t-1 C5èžB dp39>:D2&x^aԺ H_s}u'5 F8.~`JQ0Fa1AH((ĭ/@ Q-'Խ2ĦM0#wwCY`TD2VEEiFjT|B)"4#8#:yWg DŽHё[nQݢڧ)T߲RKcT Q=:)LKriV]۴OHMx_}$xm?4Q.hIBMg`ts]llG?ԁg֝U^#0|TsBҳ^1HdbB`iҩfi1 -Šmgb |%PAy&Ѡ8M&=7Y_04,KcBQϠwGGCNq{4[Q?N}2j@#w8\p2/p2@ͼ2Ԭ!l&\ka ē|L'JEŰ]?ɿ$%!-I Yl/lpo @HB^$AbF!R,,mA/'3g7 ( Q-̇uv5wDΑGHFd6,nXWq5]cocԸPzpT&il`7& 'ޞetO7>sI `'{$>y;y|Dzu鰩F8l D =,yF~GhEz! aq=BNO! ϓu_䏌>1+;NH-l[6ዝ}|%3C'1!6vv 'Gh;J H9eں[Ɋ8:Z4v2\i ava%;D#O+ {1cD5LakQ;~r1a03*HlkԻ9EN%V勌Y@^II%YDVpvdϓqyJ$%¬Vļ7E@QEU&Dx5{C|C4 "z݈GCqw4ށxn# >,Y7ߧGCD Ú!~>O"G?A| j^A<ۈ!^@HQ!j!քhCFX4x7!nF#qE<%#X8'Ap8u6VHC)!> E|eW_C|#~ {z@!Z<\R*zDרз #!CDCA(6݈oG|8 _D<Z:["~EB4 #f"sQo0nE ~q(ØD\؎1\3nC܃)"B⽱@hxC'G@|ycވ,ko#~@D5XSb>C!%W!6{vTY.Vq5ii&4`%Q[Uuzf{{2C `E1""0"""bDDDĀBnWcXd a#"jB¾C嫩.$=pʽ<]]sN,Frǧpr|[cCoԘb 9V6XۜcMoK6&rv+Z{pıwǧc8{38>̱wFjLlս9.Xӻc71_ Z8pkǧ|M98>kűmjL_}ILgr{pCYoob39ջbs+elc".uUVFZ߻֬+p+#xNjAF\-l/;z#MFm#bl4g=O'ٓ,x65$ hgPq]kkK +*^JeW&La2%J/8:868>8!81898-8#8+8;8/0($D DĆć$$$ddd*ЄдЌЬмТВ0%VVV£cÓ3³³ ËK"_DtDlD|DBDbDrDZDFDVDvD^DaDQDI鋌LLLL̈̊̎̋,,,R|QQQQ QQQiQQYQQyQQEQ%e|W$2X/ Ki;BQ?ߪZ z*.ߡ/Z)@ _#z~hAMx6dZX'[3x?,h]hnr&?{OՐQrQd2>٪nͰ'@ ]bMǷפAn,t@4i*y<ɇE(Voד-y6ܑǭ^< U-AmF;AT,C؁ |M%o6a&7sI~dYc&7g;H.68ɉMN!/7\hrO [0U9B_o5 kut%@O*_CN꤀'Yu6:2JPꢆ|ׂ:%gCx0Gj;QGvCgve 0k&O$n׻U,lO]Bڒs盜,GGdً9=d}{Z[ k+8(=ż6& 9UU{Ikɽe+grlAwE&JklR_VZE| UŢ:(5A |'gR&1y`Ƀ,gɾ,jl!3GGtl -6X4>úZ33f4lL.gll F}Kr>KO H]dK>g=d_(k,nX(_sqfr~'=wҚ%%&/-gmtREKe^CWleH#&>52;GFi2 -Ҳ~ho5 K-rw˕~;eI5~b`gdsU]MoMOTɦG:1,ھ,5NG.fX\7L:yђ-^1d|Kr#]P~K/ރe-^uwmYe:ӪC=mՑ>kdʰ\6TSv}V}_R}Ͽo2qԀ'㬺\z>h}~zU,H&$@A,ĢMx4 J)Vlo5lmqM۶q~zzl=m=q-V0%כP=Mzki+w3E2`Yy~0𰊬"ʬ2xC!PUc Ug!ŲXeq,X-V YmV"XV"Y]VX=VʲYzP4}>A0DO`>DtH}>Fh}>z&g3`>S Yz>W |}> `P_E"gX_ %/՗TGG9`V l`g7AKi8a*|e 7,4tC E7F d!F|ka؈0";#ȃ%FF,5kc~46'cr-Xfkl7rcVݰkg_/Bel [~GiyZֳl3 vfi ]`g;D븽XV +??}@qxU)vvw?Q+*Ƹ99θNŃx'x^x-ނwø%\\7 ?r_u %H%U"H#Ҍ$mIGҕ"2H҆t ]H Ǐ!H&M$䓍d;Ov` e!@ ("<5$B$CHQS! C6+6H 3a,Z0pU!K R• JR[i4V+J% odgo=S9'8_p)΁{:?܃K,sP=9r#';G %89ZpOX=yq LXpOgDA{8qLq9^ԿsooidiiTi4iti iקҮҮϤ]]]s]s]Kv͗v})Z Jڕve v-v}#ʖv}+NڵDҾҾ}?J~HIKVHVJ]]]Ү5ҮҮuҮ®Ţr]® ҮҮMҮҮ][]ҮmҮҮҮ]ҮҮ=JIKHJIH]G]Ǥ]ǥ]][];Evvvvvv":'Uu^uAuQuIuYuEwi5iui o7MυM\ĴҾbaYaW몿׸m*-d:O/@x:;z@O }}0Fro5(p C13p~s+S.WƛI&<Mkt/zqC}9 ra9|+!VA>^q `=lp?*5q?"Bbn}N=$ RQGJ,~NBH)Q\%RK]FRE׫BXU4ŭ0EW ſ_m_C'HS+j0 snvݭ~Q=^/ D`p[l%a8XҰ C^n][.}ǯϘ s3|{/^ ~{JnmrX6ZK6u!w|̭zQ&{4MC[,3l4Ey 4}B5ZA[}Rr2h%CP>Z CmBh ڊ 6@;.A{>@!tAE(:btDit?GP . ]Ek:nAɋ9y$I '^%k5yoMҎEI{UsN3y$wy<'3N&{^gAr&GH9s㤘 ')r\ 9 *#)!y.r\!wr\'7M0xBNxK"y›.30 K L6fg#[v;aM^CJeU)T)ەNe[٣U)ArX9)GcqX9TN)3Yr^(KerU]\Wn(7mn[OЧh<}6FYژ>GiSmF_K4L[WhK*mE_ }ov-מ:Dߥ]{+}vi2AShOڋKtHiLСtNGБtMбtӏiO'ЉtNST:ftΤ,O Wt!.l-]LKt)H9tͥ U4t ]KtH7gntNwНtMнtOЃ=L"zi1=AOS4=C_9+=OU;F90Eg9t.Σh H/ˮ^ޮT>~A]i!jOP4u:TWG#Qhu:VNVSij:]~T?SYlu:W\~~.PR_ol[u.WW+a^Qg-yG>3ϿuwFOxJG"ǼI<6xyf+̬ŸS4Yo2gl"Sy6q|"y5ChAWie`-D ´p-BԢ}Z9VA_*jZFw\LKu1`;"j@]#F>WϷg'8^`ߌ_oom{}q{M8^B9ʎ*x^W;qqQQus  zGCGCYor$8f+WώVVx [xqj:AW+y|E9|C%kMmvw?~tvO&ys8qydq#;׿O~OF#~?'>,~ IomH[>[9[y[hmmlmUl٪=bfUհ[q!ކx'ޅw=x/އ >#q\O>% W7 57sLA V}d.(RFUT mSWsK), oHGeq%>Z턓lSp_<ģ8>cŹx9ǫzsnFN8SN$I'y~ >q s wprvqusvq}5ߵݵõ˵۵ǵuuuuuDz>oyhGO~lʑ1Aq^ffޙGQgzf23;!B)7-}""""*" rEcY/DuXWQOf+|x;O=U]TU]ȶ?kۚu ܳl8I? +x]]70/h)Dww!uĹ#huTˊR%_5ߊ_N`¥EnKD0hJCG+X6;>`m8z.PǴϴ4XuM֋9d=UгFz z_}>F)t}&sQQO=st{^#]l}X_7; A~\Z<>58{z;UD kI]tZ-ZtO6t/-to- V O_k}zzv]ԷFp!RҾB; Ч4@t2U`6T"Y^Lȿ ?c57hIRIj쫥$_QwhIޤ5$9XkLrքp)Z3#$i-IZ|ؐLZ$7jt)]O/䎀?SӁ8Shͣܬ=S[K{ :z~J=%&( #P @iSkO&@ Ebxy } _/?//W($c;6SqIw;Ŕw 36Nt`YRk`5 WmDҚZQ\ȁ(ji7r<'tMgY*0h$[$"6a gI^u;SO%⢏'ѕ~ggg]Oş6%> >|6/\pz'ow?O 74;t_hNCrCBC[B[COv }::$ip CpP8>\8\)\9NW W W S5ippFv83\' Ƈ x/O}|bɣe10bȢ9ÏGS>Q Nx̝ƌU)Se·ɷYo}2["j  ~*V-4E=|ۡYK_~56ۢo~=;~sׇM{W^}rEϭŔ襕oRNy%7?r('!iy=N#hS%$sXZ|;ڥLo]5?:w &Vw`SȈϷ)y/պT  3puֶH^EUu 3ꉛjڕs5BTo򚻙nI)JDzbhV0fYL7kflh62M̦f3lgv5{"qҐV'ӢpT-I&8V3/jsx-S@jUL#Έc<`6glaAs9eb1-4o5oe9ѼSͩ9͜Ίws5m@مd+ɮf7ݨNfwS:լ$gx9ڋ+9zgѕуƟ,D=fwP h˴5ZCۧjGcqu[/Փ4=Ko;^e=ɞ4Oggggggggg'׳ósssss޲do7;;;;;;׻̻ƛ====={m0Fe42ZFc1֘dL3fs+ֲ(joE&{;hwdBSNڝhwiv%ڝVTBsY;Pu(K{{IWxIy39)4>6v$^=LwѤGzy'Nzww6Yyy^]]Kzww+俽x{~M~O_x!{>ex $ (AQ(OQH!]J tm4"hfP E%B3K_ҽP҃8c  d*-6Y\sy" Jˍ5ی=~WHl4>dg#}qk{'S>/t_O:>l_1_i%}e}IWUNeIgnkkOn޾F@zoo驾|H#oo)ž5W6m!˷|/~w#OI;WSOuy>I~_t,DEUTt+-mIww&? pXңIOOEz H//'̿ڿZ]}_L5!o8W `Zf&- jE5P"H| 9J:%" (1("Жt@@7]I '=40:0TS3I֯ޏPo>akW-~@K-csS)fY63S4vyl[ʖle[c_^4c5ht9HFi,:Fc͛[h:ɼM?MG=Rqg4xtePxLgl@-[}mAԷO7OշNui(FT;ܣj/h0|z<^E~ۋ \r5s \rF\ ۛ!@n嗃zpT2Ti8.=Lv .=Ҕ'[_ٱgoX;/t˓Zm9^Dk\׀j]^]!˗b%цgR:kMQϙzL~:(TKǞo8Y1䤳"!QW5cxcHucyq;ˆHU<:X`=b.4PLQT")^\a4WQ X>{o9T=gX>|3pYs[K~\rse-Wly.sϱq>^!\sρx^~\;F96` /+G4YS3H6smb~K6skFgF*6 -o-vCW<{ t܀e=Rq rtnn,WW0W6E/(y6 _U}s:q=Zm/gFmG"wPGzs@ [*܋I(tSR##["[#OGEGvDvFvEvGD<y.?|ȋnu7խᦹ5tF*G "G2ȨȘ͑q^J{)2-r'ϑ"̈MTr+In[ŭVsZN6HVsh+ wR=}O=k{ٻ|G|f>o[V4Ʒ|'w=?~<_ 8!D(,L\!E(#ʊr *JHɢ*P4ET4E R׉֢h+ډ(Ɖ[xq &I61Y.\xP<$rBψYO<' SO8.>_/WR镆l(Ʋl*沅l)[dkFd{Av]p9Bh9F>k&%r|L.r\I}f]rKvɃ |KoyD+ߓHV1Uº*iJ[ZVU*oU*Z*VU>ssw}}JޏNaK\˪ CLgb#VulxQƆo-/$IvbeWylSUr {\>-UTvhY#c-mU*W$+jUR6w{g;ql_—28_W|_͟k|-MK7ÿ'w{?i&t1D p1Bh1F7{,q-sT<&6];.[8*>8%NK&5YEVd.Se &ktYKf2S֑Y̖d^(ɛ`9Dmr]Nya9_>"ȅr|TFkYA+dBVU2-aI˲lXUJsϸ{ݗܗ\]+ %PJJ9RD)7@)B)C)@)D)C)B)O@iNF ދe7eAC*^7>V3=|9~>?ya>?|/!??)'/DoGD1@ 7A&1XY%"fLP,b 6\Il[V8(o!8,G ^ Nʢ,.KkdIYJDYFdyYAVde$eg[}e?_r('Y^9['\|P>)Z:yB~'?ȓGyJY屼a,[Nw}QGy;ʢ7TOR=jGrE16Q$Ӌy.haByԸ{ӥE KDM>zSCL;;۰ۻ[mw aaW/$XGٷNfw?zR¦P\eeZV+z5R}ZbbWdlu^dۜ2ZU"Sn#ݧFl<n4fDajy,tǸhR|򼧓~9,vf%>ZǬOXZm}m:MUc{mqvv涴-۶ v ]NevE]ٮbv]N'hU5ptGwݣPmo C4Vs:E"c,CQq#Dqu/WͯY[ۭ߭" ;azSXpk]"usJ8%N)Iv^NpҴN-t2~NSO4phNFU}}^ uriB !mD}Id-YJv"R]dUl!; !Il sx-ow>՞HO=;njϐ,|ttޘڲ/6Y1VQ̖>37ju:YiEXbiga\R5?p?Luo[QXFSH1gbvD O P Fp5H1Gx&zHśg:cܭL-:n{ ?9{1FQ6ʋ5Q|| Vn5_ 5|3Epɇ:ʇ,7Sc9'R+y ?d)yDmfL^,RUB-ƓӨNgwܱU؋EF9<ILۍsV7勅#\jQTZ\+E8 ^WkX8[8)KȒ,r"-Zh]8ӫ(kE VtZf*K3g @ufPU"VeQV3%EBoa^c ԥW`[? b/٨oKOE ]tW{z<6E'XSid}uȊ/:Vsffu:7Q>JOEXG{.i\5GaX5·ڴ Zk*l;va׶3vX|09̷ۯGY} |E1= ȏK,+}D r,%.r 9u]WP9kS& Hwӟ|MuWիWU^KC{k-b1.  M٤GzQTŪKǓDBօt7Yi;_,++l`g =F:P+6l1>l)?el06ea>p9odY,{6igheha.4RoF3%_lk1X9,F)>4YL}>B=s.JeuxL֌nd-HZ^i6H};GZ-"^m As.!Y{=p?KPiHWXx^%Sx:V|%jT.CFMQMf:f*[c[˱Po].yeo`${ʘ v%8;4;e\۵Y}ۆ=fEat|Dqbei!?04ߩWg!~/+RIoI321l65Xes9jQ`dq 5 (f]Xdwfbn d,(~v㯪91xOG]<e:OWgUw~v~fwjvn7d5 \4ҙ?||Oy,w[OlfKb{bv}maM.edogvnkw;ڝv;jwS4ag}v?}y&Dh-qU+XMM_l`I~e/Kp/#11Bs-27oW rsur$KGKTO2 J4C$O[:B2u\1l9.S II6I:˥+#&ˌKVlSXo\X#)gwiܒtr+ռ'w?p7,_r2E'WԖzijw[NvZKUT:/8 EFɑcJ0GiY,Sg 憘W/g1zE"իUX1a}7̺+C;e4[fk5{|̜˚`(L}/$J"F 6UB/n 4hThA}mD{֞L 6u_p{%ɇE>`ifO{=3;ӌ{+_y<5cXJYq%VS W֛{#c=y㇟"' w+GSVBY }dGsU%SFl?Az̋٧S9 g#zYk1_ZMīY۽1DRss v;4G$i#|/66JxZJ~c$~S$'.,H/|+/Sk\~{xgYMϤsG"k{ote;%EwB&m jlL#x[u( Ղw;;__ E we$^ʭ:Z%vH94&VĪ#> |/M% qNgf, [rxWmL:C:0!e%kx4Z ')m]z"%KaU%v!bz^ϕ:#[<j!t& [& Σ'a> o|0s*Cށ9dyu"zwLGE61ޚ?W8Jo>y'=d<.8d<)8dr ܈TXvYT@>͚?|hL, RG[}5q]F]b.+Hbׇ,3<4ϗwMXIk6tG͖;F.ӯ 0 {ϐJ#.z&;̂${]1]nѩ"!%6IqV32B6kU$WP!R+;X'L3Q9-4{;P=;\!Q=SdUS$|w"aޗ h%,+U !XS{1>FCx}<Y,V%UU0~Z?s9vQ(466Vhma~#HfAtc1FGGiL=ה &%!:9 Ґ߻&=J5~=9;l 7=-g(pZߚ$C:Ib.I` v%+]Z^.*P*Qx.Eui*cu g9>/<E&xMRl{ma;Y$M;'R,TF %HդRm@j,5ZIm^vyH`3JVאxt*Px*RIQ/JIeJR*KU J5kH43&n֗66Z TT)0CGOD8HN8\E8JK8V+(IEJ!H3 gJoOmGZOmΛ܆'ag;pn}􇠏~ A~/-o#'I@iП>z Ow> z7Aix{@KV@ +^Aǀt,8`95[A^)#ըwpſƺ^]Ց cP&9:O3ܭr;d>܊< w9Bie^]"ݢXpi8az-#ϊ;S98Ӝ,g3yyyyYt r#ދF,s\oq.q=ײ8줧(.rr8,@Y`9qa9R *y; rp޹g˥4z:]7Җҫbqcu|ˢ#V^5]:^l^a u^w&u[sl>6b6Y!X̖l)X̖l)zI)x2O|OoC-A~Zx.VVcO Innm~jt]CݷIyrG9YN3~y.T+Եm=#u[R=Q=T$xyjxj{{yzZy{= O?IiٞE<J䶦Npp60qҁ6cStWOgLq@鵥mR[Em{;5乷&;\C{IXQGp#3$p,aG툐"d9~8;!v'BFCs8v'88 ODgPSÀÁ3)eJ 9uF9tA]C9top8pp>pp"EE u u x`ppp u7QD]wuMu7ԵvGݑvwPYc<""""HzѷL3D!;\fem 6 t<[ĖMedvJ"-QKTJ*'%Hե:RCJ(u2ag?%)צlʭӃ*u"G{-Cy8O./Q3((~3-BzDQ29MG$qAgm;)D }q@{zP_h2}&!#Er!~M9L?'bCHz_Sp'bZJh)!x" ZJZJ6rF!9d#lP''y"l PYY1@^׃D]u=H Q׃4iFڃAfw =(Eh<)BIƓ*BSEh*B =(WӃrуrуr"zPЃr#=(q=hЃGBуGB/B/B⭥9rzPЃrуryi_----"y–VIb+e!Pw;}>vǸOOcݧqxw;ѝ>NvSݿϸwϺUjwR9Ds˱EMEm  IIŌݖ_ݐ _DE}:"I˚;Nکb}qp3R9yޫ}u:jQ/W\.hRƩ/P_+pGOHz F?/w:;FH(Pu)Y\xs=mB@_!``ɘ`^1*1c]$c}71&8cB73&~<>/Ɵa4>᥍ P2dhUFTݞ,Emr?;ugH.]K}mw&7㩕!.+zJ1$$붬ɰ'}QB9cs \ a cVx^h?/_gKH6Ues{ c6=yqr|+ð'OenY Ƭ#7kRM6`u+Q:J"we$Iߏ bϰQDeDt ҢC-o'NUYx+^B27USKYAm6b9hCakَ]+q_ZL5jUY6Q:ZRm+5jM׎)oK&⛏ӠodYfof́y1111ʼGa&_ܛ˹9b=iuT9XO`0 < [2wJy;:#u~%ic4Wý$|^IJ ͕12V{B(_i5JSOWN287%)Fx;~x?~)[ֱ]x/]Px_(^wkOSxqclf&VU܅LvӀ>b&떻~HxcHx5V{9My į霶qӝ\RPTK3<>+|Kn_a>fl>lrX5W)*A]Ԡ4^/z.G}_6\F4${z{R=}<܃Yr!M\ Ɗ=7&=J͋[ƭ[Ϫ+0w4{M`||br6ŷ)V>}V|_`k|_bk}_f}}}67|G}Gٛ㾳-^)>ﰭ+Z1iŵ;9Zx޼ѺѱAr+wڇSra `"!e?tq+|Q?ӿXwqwc"sd[~ߑ›vA.]NJgIil)GZ$-VI뤍һfiS'I?Hgd&{x9(;r)\j:=ur%=rOl#O&$`[`;`{``'`g`2`W`7` 0Lf}?> |88ppwhF3R"]݁{{_ | 9aǁ-O["avZnm>{[׭kʋQ3ܰ)?.T~  p3CG[? Xx?.~ȋfGGǀǁ? 8888G`em*ہ܇U[('%!9Ѕ@B%ЙP<gjWf?m8 -*+5~ niN?O> Kᰝ4aJ.@#aXif1W̞ʹu^=(Bm#)dp"=0 Q^5,/F\09Y|V1&O_3Ȏ⨎:N1'qa?;c::!Sҹs8J-NeV6s;q`7 9t9r;9MDipZ:IN+a& ńbCBq !-T<B^dvvUYo>fa $I%j2Z+C.xҞPjSͽF`EJtm >n+sA+XgNsc5BEs|\bb.5_5Js|\c5_7י W~ k-|@|YstGw%ezM}}YHXߢoӷ;.}Q(m1c"s(JQ_B+C6{-VNN[Y *Nq'_n8{% 6"d &v;'ITFJjJ RG)]ʖFh͊¾ķZ.s/SI'X1n!urF;Ϣ]Q((zO7*EEFGчQ(h},>EEE8OQ2q˄{o-K Φ(RTT[nCեWҨ6sk??>=A0IwUW_տp b#Y ldbcd0BpLldcdbd3ȱ1Y"A6"Fdc,Ujf2ss^ꮪTSy{^ڍ]yC6h d' "~ 5or8ƗxM?yk'SjogjƟqZP-5R/jQ8_ƹ7ԕhw"r]NL˵F+ח #&*יJlfY94]rkkF4g45+iͬV]"_)w}ڨ6UoV+DF5ec .a2k# Q?&Je%ةث/ݏ:s[5u .QcU7ɥj41ƬԸ\S5nTjܦƧت}jT?~oq\٤jW8oϩj_OռC_/GԒd!=B.!ߎDŋH~FD6??Sv587{-4JIHt#<II%}gz լ]%_-,ZKJK;t.DK(T(22['J?oF߮~9>;]vd.7k g!j$CSK=DPSۨ"d|; 5KS(@C)kZ)vqMY CE*::2ʺ|er/õr'&/fnJ=K>MQnCy)x*@"TQq*A%2TV^c_qs~UK}ZgE,_眈GtP-7˿軄J+Wwf *"F%ۡeTOT9NjԻ qjnj5PRکR{}~I?CF-T1j+$ Iھ8?ez1+ѿr#ߨn abX&Z]ⷯd?R~$EVwd|/-]=M"?A6A6$wϐ-#x5':d Rj%%&ϨG :?Jn"tQ'dA~N ٵ(V7"[oL"H/ȣ>~+B6@~D.e#[r Æq{vq{[Vx@??WpA[Xc |M{21F @`d=E^汬0.p#QpӛFSLax0Vw(bЪD|z&,˭]In{m[MM6[}͐>8Ռ- ͤfJn#h4r+H[Viy֖k+jmVmCۥ֊^mvP;===UR<3^6|\.%ԃhi͠,hC`10&`9Nj \րkuGGMxB.[o<N!CP >|[998989898989898989898989898989898989898989898989898989898989898989898989898{[:-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN ~Kp:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:p:~K%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i NKpZ%8-i?(nra,oRPAA4& ZA^A !0 FS`̂e`9Np%.qp׀ׂ?ׁk 3ض@la[f 0(`;3%8VN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ8-iN pZ E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-iNpZ"E8-i etvCa 9jD%AbϽI9b^SZaNk8bX'..T`zhDV}mQX Őz%ëL-U'_m?]Oa Okx K>)u Oa Oa Oa Oa OkP,!|DHQITDv_~v戇l2rS}->?P׳%r=*Qzt HgJO ie?ُQD=;zv .Piu]yu٬7`+|:|95#ޯgzv A jZ|6/99ւ[;xP 0ֳj=;zvMYs +s}1ѰENK^OJ~%_*im5lk2?>Ӡ{W_jW`ٹKfU>>~|A TJUKEI(i%͢Y4fg~J_,)-R|<,ͣdk.}＀w^P9(ro81T:"'N!&OudW^"̏y_R} y_¼/=`qtmBWQgq9ە,gyac-ĸDһ^+w: A+c&e]I*KW%;yZӠ6\Oc,W Xw2d6\Oe4`] 2 L{[t)Vy/(ܯg~}{\u޹E[^8hn%Q*OO??q5jTB !BxũρJ !ZBH-!-{=kѵgN'd@)))OuL7增a}!Lpco<@<ƒ *s\-GjPZzt/辤;O׺~+^jʨ9:TGĨ9WeJFI|޳ߪ>b@yR_-g>a=e 1O lx vAݦKL1>CXWH^yK4W6Ж =|xpcqE}[>th)&]]?vT>>\.mD}RB.P s4WF' /27l4l6l5l726158l G ' g  W 7 w h.aNG$^I5zFdG4=J=IO =G3Z)ftDKsaZ }>O_/WM6}L!Eq2>&$Jf5a60-6fĴ0m>9az>fbF(3ƌ3$3L333oF1Fƴb1Ǚ),s\f2יmsH K%Fbt}ư1i\n\i\m\k1n0n2n1n306[m}N!c8`2OGcqq8e6&TlҙkL)jJMJSTg75Uƫƛ;{&ThZj*1L3MIrJjZSiiiiibj33uzL}Ӑit4j3&L)Ӵi4g7kEb̘Y3gQs\n0W͵:shin6.L K)l1;>s؜4/7465ט77w-6>sg0Ģͣ1yKؒ,X6X6YXYvX,-6>K別g YF,-1˸e2iL[f,syZd-ꬌrV kZk[֝fkav[Ek:h^^^^ 5 M-m&kͺi=d=bYCiu:nNZuղEl1ce9gl-g+Jezmdwl+v]l7+l?;'39{^coY.`+--#v#lC{eqvdivcmZ[ئ16x[Ԗ*lj[Vok5vښmv[mm~۠mvvvvvvvvv6kk[ؗؗIn{A{ܞ%l}ېmv6j&l)۴m6gkEbY;gQ{^nWګ:{hio.{]aI9%5 -}QXX &qqGֱ±ʱƱαޱѱ')}>gwhEb8XQGQpT::Ghv:.GCt:aI9%5 -ǬcY\\$&qqgֹ¹ʹƹι޹ѹٹչݹ˹۹ǹ׹r;"gSdsΨ3,wV8+Zgltt6;[g):{Asy׹*p-q-s.򸂮+ZZZZZʹ$Q1q ŹxWԕv*\jWUjp5v]vW]~נkuuuuuuuuu5Z %2LpA.e*n [m6s[.n7raNrǸ w;].sWDWru\=5r;fk:.^䆹w]q7[,w[pImw{Awܝuprqswotovouowrvquw܇ݒzUfwrwEw=vtqs_p_r_q_sprϺ<%ec=Od=+<o؛$<~Ϡgsssssssss3YxxyIkzAoܛnnnn漇J||a_ҷܷҷڷWDTy/x/yxyoxoygw 23>/U5u;]ݾ=O]]]]BR~?OWWkQ[Io{AܟooooOR70+Zo|·N~q>˯Wkuz~#ow=^~??Oy"_o;( , ȍ% @2<2:6Ph C#@_` 0 ぉ$QXXX , . Ϡ% `2<2:6Xl ۂC#`_p 8 ǂdp*8 CPQ* - ɍߐ% BP2<2:6Tj BBC#P_h 4 B㡉dh*4 ͅpQ8 3a6̅p IcS󡋡ˡ롛ۡ;{a"\^aKdxyxexuxm&!)%-#n ;ÇG=@x(<> Tx:< GHqDa"lh$)TD*#ՑHQ>!"!b8#H8,D6D6EDEvD"-ȾHgPH' EF"#xd"2LGf"s6Z-LrQ>ъhe:ZGѝhk܉܋hIDQ_4MFGWFWGFk[ۢ;Mіh[t_3z(z$D#Xt<:NE3ѹ|L+t1&ƸұXE2Vc Xs5uźcb7$b3担cXMlClSlKl[lG)kuŎzb}Pl$v:6&btl&6kE.8x:^Wƫx}!oxw\*:6^oC#x_| >d|*>DQ8K0 6%D4N'*Dm.QhH4&v&DG+ѝ`b8q2q&q.q!q)q%q-q#q+1XHUDK-/љ88I%Chb,1HL&Ӊ\b>M%$d\OFdy"YN&Ɇdcrg9ٚlOv$I1ٛO&'gWג7ɻɅTAjIjYLR'$G=ɾ@r(9<M%ǓTr:9KΧTqJbRlKh**OU*SթT]>ՐjLL5ZSTW;%zSpdL\BRJZFVj6u7.H/I/KiSڞx:^^^^^OTFScDj25NͤRim(]֥4|:Ntu6]O7;t{#ݕNtz0=>>>MM/d 2K22dƔg<`&fVdVedeg6f6gfgvevgU\z>e3 a3\D3Ly"Sf2Lcfg9Ӛitd21ӛ f3'3g2222W22722lAvIvY̚'Ƴl.{8+efUY&f,flE2[e ls5۞veb7۟gOfde/d/edeodoegw eeKʖe2{,X/˖([Ul]e˶m/UlO޲eeRѲceN*;[vbeٻח8uOe/v\\V}Uߪo=8 DH "AB " "v!'dLF2 AB  !HDx2q=~^W:$'v~>\u.ǮĮƮŮnnnbcccOcc/cbobbbb{Q$v.T uB,-BJ B%}€0$c„0)L 0'’,š.l [¶# ¡p,E&\n7pOX SRx% Ožp  'y:^o78@<Ox{+ć#D|2>sq9_Wkf|+߉iI$hKP &"-{^ ~?'uDsL [$T"hM'=@b(1KL$& )1KJb5XOl&ۉnb?q8N&dM>&$dlKI!)&ɶdҒxxxxK$'du.٘lNI:iKd4J擭dW'ٗH%Gcɉdr:)%rr)\I&גVr;M'IէRLMq)>%T1ՖHuzSpj45$Gɓy:UjL5ܩ@*JT{+ՓK R#Dj25Rs)9ZNVSkfj+ISiIפhKSi&ͦ4bnKwӽ`z8=OJOgҳbҒnNi:mKӁt4JӭtW'ݗHGcdz:-rz)^IVz;MSkz19Qb!vb8(xKgYq^\'3!"-bJ̋b%}8$c8)N8'Ⓒ,⚸.n[ⶸ#x,fLM>f a2l!#fLG;ӛ f3̭Tf&3,fdede^d623o3333_2_32gHKf 3Ɍe&2錔șrf%Yˬg63[Nf79gNH&[EX2Y6el[#۝gxVv*;gOϲ/ٷُ/ٯoٳ&Wk5刜!gAZRv.+gٕjv-ne;~0{=!\}a9*sBNsm\w7ן Fs[Ln67[====˽m^>>|m!ߔ'%|"__BZrkfn+sihSy&<bow`~8?OgbAQIYE~#:6>19%5-Vj Q0,gWlbRppppppiR)V L-p BV(tz pa0^U*f ƒ£“³‹Fum}csKk[ᬨ)MEh(Z΢.&bgrJjZzFfvNn^qxTfhmeP=u#Z_=?VfhCeT=?WfhhSeZ=*GQ2{g2{D+.S2{D #jQSe2cԂ*GrTfhc~Ec厔)cj0 Z{2ՠIP=mmUfh{e2{D;*G#Y=Ѯܛ'2{D2{D/Wf?Uf;[*wTf{]^r7?W*G2{\=⧕#?keH #QU=2{$+GQmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmPmG^u@k5P{ Խ^u@k5P{ Խ^u@k5P{ Խ54`)Vd5c5J`Jb?(Vd[%X XJ/XMدJ5+ٌJ$ib$SRc% $ٕc,Pҁ9tb.%]GI)a^%_I?P2 aa%XT(S2%L`I%e`9%sX^V}R[ՙF4h4Ơh&IhKNeU5u Mm]=͂'AGB?ߢPաFgьZP .ԋ "060+ް ڎ^A\ ~$s{$SHFZ !l gH W $I@ )H=id -.H7B!Ad2)@& "d d+d !N?BvA !/Cdg+O y 3sȿV@ 5AVC~jo%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%0-i LK`Z%4]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]%0]RMMe0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e0]e4-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iL`Z2 e0-iLˊNĆ#Uf㻞UOo~7kڧ?W7>qaOۍ~y7r4׍oH*gAZ.q_x/^v |k̀Y0'XbKX'v]ŮaױM6vC{^aow`G؉rfVʍ TN6܍(x+ގw=x>#҂}Q߰3] jB9O[p'xKx'~_ůM6~C1_owGߓs#f$hF%RDh%ډ.#!b#&Ib9B& a! "K\$.e qF\'n7.qX S9xE!Oq@'ĹZ[m6kI-iڀ6MiVmKۣh#1vR;sZY]֮hWkuv i&YE%mvA{_PXT\RJFNAI=iOd5YG6$IҤt2J3_7̬1ךMfl@ZiFbYbfYc֙Mffv]f9dS3b1כQ3f̌5sf,Esf0w{Ay4O-Rs PZ8 o,hitX-~ˠe2jܲLYf,yˢerfXk &+a5X-Vg [֬zzzzziZ-c˩X뭨RVZ9+ohmvX~u:j޲NYgyuzfjm &a3,6g 풭vvvvvvvvvvv϶m Q68olhkuغm~۠m6jݲMflyۢmvfk &;a7-vg~~~~~~~~~~~Ͼ`ohljniy`E{mQ}>cO//o3Vֲ lK:Yfl^b;*{`o;]g٧s%}þc?==BZ^dQvN3,;.G`_oG3~cG taG‘u\t\rt:.;8:9;n8n:n;8:9O/o{Ǒqv9NiqL9fyǢcq8k &'48-N ;άyyyyyyyyyyyϹ||||||||s8'sWjv.es]Wԕr3 ̥qպ\M.epY\Nv%\YE%Wkuɵ:pN\jw&ݴv;λ[.w=BZ\]]_\_]\gnnrnv};κ//;ݗWW77ݷww W7wO=}>T{>>>~~yG﹯Wk5Hܾ/KV_ |#1߄o7|s>ٷ[V}kuߦo˷}cߩʱi-^^>>|#߉_7nyC?K9_/W5ӿwC4jhL p> Dɿ?O@]1 tph Z큮@O/0 t@ R`9X v`'A$XA,H |Pb-HKCS`/p8 ΃`c9H-`*ۃ]`_p 8 ' rp%\ 7[Np7< Oyyxgxxx/m| ?̏-~gfiƻS|o.!~'I~9^e~_u~~c4jB!4bC\ !1T :BݡPh04 nB3|h1 ($,i CP4 CPW' FBcdh:$Brh)Z BVh; Cǡ0 ׇ0L sa>,p1w{px4< τgFum}cs  Hx,< O\X/+Zx= ow»a8|A"5"T.G)F"Ho?2F#"Sld>yyyyyو|||||E5hC iLD&#)2#KJd5YlF"ۑnd?r9FhM>F(elQ!*FѶhG;FTt&:.FDEDE_D7o__ߢg1M6k1Cs|p,D+Zt=݊nGwa8zCb5bT1.DŽ+b{=c~WW}fR!ZK8XԺZF6܆e""""Rc6l!fC̆-1b6l=,}\ttttttttU.{33˳ʕr<<<|\rrrrrrrrU-TTV{Ӫӫ33j::::W]RTՑhu:^cՓ3U?~VEW9ǪOT>S]\]V]YnnW?^^^^^^u )ڴڌڬZ֪ͮͭͫͯ-Ֆkpm6ZlXdLGOj>}QU7L}rԜ`mCmkmWm_pM׎NNޯ}Xi\|BbRrJZ^OOԧէggg+V}v}n}^}~}A_Շ#X}n'g?Ry_׿__od5noѸqwSsG'?\~~~~~~~~(446z33F1111Xo 4Íhc1ްc35>i|EW4673ۚ7hټyoZ|hͧSsWך]BsJsj99999Yis }%@s9i6ǚM<<i}EW[ߴ3ڷhپ}oZ~hۋK+ګڛ;{۲ۧgSs33۳ڕv====^oh{=޶c3?iEWߴw2ɝ:wٹso΃ZyhΓ;:K;+:::;;:{:;;;:g;?:?b.X/=[KOqr|)_z_zSKOKOKO_zSKO{SKO;{KOKOG8-8$/=xo|)Y|)_z_z_zǗ_Ɨ_ŗS/=R|)VKO_z_zŗS|8/=ſ/=GKOoKOSS_z_zǗ?ėS_z_zOƗ?ŗS񥧸 t_/=_z/=_zŗ'_zz&ŗӓ/==ӓ/= &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&81ԤԝROJ=ZZZLmHmMJKNԉS>MKO]H]L]J]N]I]50iʤnL*5{Uԍ덿]-ot[:DuFw|f =!~?r?/ov]OgғӷoOߑ3}wӵt'p'OWWץ7weڧOϦI韥E_ML*ܚ)f2weܗy S42e*|Ry— _)\-\%s[n>9 SoZjڍwөIQ.hTL=0*GGM_RpjSx#yZVt =z}Z@iDi/4N'._t^g>t& z?K+:w %ZZ5!?l:>L'} K}-}G>N>ADOO O&?4if);P6!b"6!b"6!b"6!b"6!b"6!b"6!b"6!b"6!b"6!b"6!b"6!!7:        ;Q6hhv({'{'{'{'{'{'{'{'{'{'яnN|!E9>OR"]F~]A_++tJWtCt-]G t#fnNwНtMGktKt!zSPIPK4УuzA7 =Iߦ;4}ѳ_vMq8q8.q{Rt-[Do=wE=+zxW]ûwE=0=SH`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`.nH`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`/}Y>G]J_rO_+t%}W*5tzntLЭt(}{> =D#tNOR"]F~]A_++tJWtCt-]G t#fnNwНtMGktKt!zTЉgZꨧc zIOзI6=Eߡ }$67m$FIl$FIl$FIl$FIl$FIl$FIl$F$FF6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6R(~6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6Rhb i}.y@2ӗ 2]I_Ut k:n0D7-t+FGvn:J_{^c=HJ:55RG= (}oMzEOҷ)=Mߥg{,mi#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6R؈g6RH%6JlFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilF\ߴFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilF_Ht}.%H崟DWЗJ Ut5k]KtH&n[6:Bt'EwQC}t?AzG8TRE':iG}o-zMOwi.=Cߣgil#MilFilFilFilFilFilFilF<=lF:Qb 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 6榍 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 6BGst1}./ХE.%LWW} ]CZF:L7t J;.=@C0=Bǩ*ӶQO=J_8}oѓmzCOw=Kcldn`# 62`# 62`# 62`# 62`# 62`# 62`# 6a# 62?|tVw粆ѵ|}]w<6y#&|6>y;Aw]t7+-z#71-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-v;-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vbG-vBGst1}./ХE.%LWW} ]CZF:L7t J;.=@C0=Bǩ*QO=J_8}oѓmzCOw=Kc;Zho17-wzN-vbG-vbG-vbG-vbG-vbGvbGZb6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#66ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6BGst1}./ХE.%LWW} ]CZF:L7t J;.=@C0=Bǩ*N,]Dt }./et9/eBt]M:Dut=@7an[VtIwtFнtOz:NTQM щQ:=Fߠ}oSzKYc#Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑FylO yl䱑Ol;`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`wti6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`&&g"]LK t)}.i?}/ӕ:@_j:H!Mt3Bmtn;N5~:FЃ=Lq*jjz:1uzA7 =Iߦ;4}ѳ4QFᦍ6 (`6 (`6 (`6 (`6 (`6 (`6 (`#6 (`WQ]{=/dNNbc C@DbD^Q6EE"R.ifΙGq]Z3{w?l8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8Ud#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#ldɨSPNC: >ԙ>: gQV>Z\ԇQGB}u꣨ը Q.F]j 㨵O.E}uSQF] JgQW>u ZQסE /nD}WQw!PP7sz_nF} 7Qmmqd#.و#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#lđ8G6Fو#qd#l=lđ8@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6겐l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$@6FH  d#l$7>u TRiQgއ:~rPg u6 Q+QB0/"]XcuSLg%JL/?߿J{џ.>cxԘq |b*mwG™{CqX|)/۪]zBϩL)sopEa1zW9Z׭__!}~)5QizoY nC|^Q0T`lHf@e b!1?1,bX!U!NeBܙu8A|⮬+׳!Ng!^@y< U(wEע &.qvh kS!.\qV Bm!ċZ5;У@1ЈӉ1+y5;xفP3Ʉ2ϙ-#mcQW5(QQȨ5 Q!.Qc!5QC\U > & ZŌFc&a1'4B\ hWڛ(>>[T% *0(2/r_'#,~[UAlѭ A4 ]/ #Qt Ϸ8r1C[ph8N"qD؈Q#ƪrSh%jp]3`9,mlm|n3LwbyTلsi&. L7A3 n&T=&&f^f/Л͛AЇ歠5n31hNdB4'AA2ЙLY&ܭ9ۄ5+ y<* ڄh.6>fBM6kZХRЧ̧@6}Ƅk>k> s &eA_2_}لJaj *Lx&s͟n67a `6k Ä9b4w2w6w15370426àMf W&kkoo@5őoί勂o3W}}ۿ닅87q_ ^Nf2aK7}ۿ˗ }|} 7#ˇ}AAۿ;7 ݉0g#a&B7QL< 0+  8*b_qt @@Iw $C|U*S+T \ @:l!p#ęL ) 8;p3ĽJ> qN6s}! A/ #0"$.!+j;-`*Si)M@[Z` pxGO/Xz FWFC쇚ŮP>tP>,`trɁ哦L*.''OUF H$N&=K&y# @B4XIgr鎹B"Ht$4G¹A:X(r O&I rzG}HG.3kO"Lc CI˱ #W z]~yh"#?厡CԂ!IFayĐTrXr ɔ{tG:n2sq-"wLL u;.ԽPQ?Ddڤ2zR: u)~CM~z4yԋ**5jƄiJ,jQwB=zRU PWrwP̘6cz4K55 5Z="ОZYeF,& 6j}-yZh?mhmweF mAL0h7hv&^3F^LY8{&7d<@DRB&{d`ʩL# RF#3,fYGFnii,>0n%96K<ҏ'$IAd0e)Z`nտP:j7Բo[G*XT&T?TXAPU2FPc:A- 4ͪ g~&AƐ{X22Ef?Y_cwB2$wQd4)"wö2FŨQKP'ދ:u TRiQgއ:+I3=tfJVV:쌢*~'|aVkFsD__pE̋X.>b{#'=>Oggg1RGFfEEFDΊ\y0$1eL1QW[s[\s qvKۭk-{TҨ/jW[;;]]] zy 9IɎɏ))YS7)xLs'6[[[[:.!volS8O\0.-.;.?(42&nu\]\C޸q|S!*5Bu@Sx9/}7)x|s ӂ`Q4X {MOB0!-!;!?(42&auB]BCބ ͉`bZbvb~bQbibebMĺĆĽM;x:;uߡCiJ?wږP sZ,d:~۪ca"r||Nyx^qx>w5pK ٯuk&EL7پ!+g|-!9t̯mlc_*TXd=8oW`f@ s,22#R#zl'~HIyt\ݶ#>Y1җK oJBzO/~ߗO~ )Z@+ZUN*RCd#o%I':1>)4flKi$G r\*5&Tڕf4t -,:VZkt }!!=JO3S,,fyLf9sOp!̱E-d0S{1fYv6ݳ̵nY=OGdF%7l_X.=Y{z2=Xtv`*}]1-UӶ6>,7A^=BX;TO_%+ŮjWLv]ad]+ؕ3]W6oYפy2y#_7BC~c Eo!7AdoSB٥!9<2֑1gIƛ/}r޳Yf$w46)]M1:aۤ_lC[L"󨬹ɵsY%\e_dJ2w``/Ȑ~/e=)IYS\Nײ|-kןy3XH+nl;"F2g쉳:wY/ȾxΑwQa(9:bJ/\%۲g]Q:/>Z5B{0{ϓ~[ ]Q6r/-KTw?e{=I;wHosJ k=+ e~v(~ۥ J_ү~}d@\KJ}M1osmW ٗCc6K((<,R6M)vG>JZGERb0NP6, 6#*' O2yWG>БOwKfGns{JQ=[X }h#BGF*f6iJ?6r$˱|uL{J_F*_pmJI~h6)rDJFYKF%yak2:9<Jx>)֑W;:G~ jφO!ݎ#\㗭vy#ȷ#]>S>G>ؑpGϿ#pَ<ϑgO:<ˑv?Z=]J oio(|#+Gʑ9Gב79clxFu~Gȳy#/t%|#v+FGőrǎ#8#6ב8r=0;^02P2md!!u"* ő1~q=-wlL7;h3ϱn"imX-[lVCb|g]bqnmڔv,% Jlj_fqXBTB5<,P83qQc!vڲ6-=ie+Ol6mvD*똊y;8㒎;;^H-s=h'&H+bUGYt˪Vee)mؑ.{Җ ]vMSzZA67Tdd17ve9`ř3˻2ւgmٶ=}r}f֧(i[SoY2hnvyhEy+y!+?ƃy?q{;޹u`A[lj7nhХCӇUۃ8fƂ`.82`g C]Gt- mE`9#GqIJ4#‘# amweߕsASA;QG={Rn8sb3u/uɗՔ5lVI3'N9lk9|>L_RQԃC_ypGe2ry懶<ĹsKἇ75ry<ߘ}~( ݫFUVͪZYj##YȆGy -8hђG=zڬN.޽P]pEƢUV(,:tŬ:+=qmVK'k+fUřW̮ V swLpp~IlyqP_Ɛ35 R;e/UYǀ٭bރV-ƶ=] WU{~-X zWց+u_~wXş"Ku:>^>t}Yɮ?v}ߣUZomxBKs#.,΁g*}9]6P3C*ju6rhhݥiuW]ÖIXlcaJ+Uq˫\UWV {TZk.Zɉ3=ZYK#5%δ^YGCWR^pռn^Y9g9ɰ2]6Qpa$m }׬>^:c/=޴GJ>mZ=T<[MȬ^l.ċ,ηͺlފ#M[f+\2\BZ O55ZVP+ek}ZҊC).?`dCdk.!f{Mk?~w?~%-ZWiQe}OZ[XɡU}`@P+-j46;Zd 5`#%=i %Lq"+[*PPY! ŽV-jQ="QZ=n V]ܖcwY 9m? 7{ꋻ=ѷؾӂxnJGsuVo4tga|]_VFn wFhr/MZO:ri !KrrWYOg4&4^Oާ )B g!_qt9I'N7gt9KWZ, ZG;#|fXA3Y6˦-Vڃeyӛv'A4 cml$Enz;Mwl2Meet +gi`]1̞d+t=Ggt6{V߱F,;>/+vne9}ǾYB(7K*ݧ?=*A'*%6*5r҅6)]_GʍJ&XROlfG]Qr?\%W<2HBO((RLg zQ)W0U2]c.e,s+J=([-,Ry[y/0_ ((_ºj_r>j6B.f#-VnS?ՃglzLma[4a4C3(kk?ijڧڧvLHB;Nkj1;;=;SؗK7Y=JbuZ􀞤(Uz7ţߤߤt{+I}r~@W닔1c8IIXJ_LԟџQ&k{ze2CYY)7o*[w =}2_߭NyTge\oқ#qYkE\Lyr%+uN,e+Ǖvuݮ|w V) ]QHH3WkkD9ꚪtMsU(_*]\̵ȵXU]5UkvvV}jkڨƺ6~ƹ~'Wz]՛\g\ WZrwv1,w:˝svQ's9DwZNvvQG Dd}~wR~:]^VSr?U繟t?VWר ܯĽɽIq׻ݧߨoߪK'#HUE<Q0"g##՗""ԍ* 33^}S)QLLULLS[=3=3mٞ/=J33_g5=3ϟ='=G׸%|/2}W^׫/FycZoП o7UI_}ĻP_]}Bi}J9}wwyޗo4wLL0;4ϙA-Mʠw2Jyv֝- ʈ# ʨ$lj@v\I4@ h1UnH{h-oUG(SB[ڶ>V'a %*~&iPX RA"BD@I -) 2Te*RFmAb_E$(M $m$6&f%Mx'y+{<׹?g=wVΟ^gUGgmT׋c'1+|OHvO'QdohLfF՘>*+V>aU4p5ЌA+EсFSǽV J@XU4.:hєlEW*3CwMmhSt3hS|4#CŇhJq%.Əp nl_1.:}1а仸bf4y|M?1<ұ_\v5F(NmɶeŲtvȗÓ 7ˠc̓FLֆ],%肱<઎hO6t_oӌ76C~x7޹vFhF(*a#rQ2˵F:H(#<3 v3?c\pQq0E98g礂(ΗWh2cdfF;> ]]GF%3*vGb*oӌ6jwVygl[H',D!v܁;S܅n܃V-m4bV h?C֢a֣+6 mR"uoV|𱹄D(]eط䅶acFт5hŻhC;:O|a/21Џ 0qC4/cF.98 p!. qq%.5p#nٶspwln xa?^~bG!wG<*Q{YQqoh/ ܀1a+َQwq .WWı+'wϑã8{ atY4NthTh.l2]fv.3efliyiyiyEɘɘ-D2軡Kִ˚vY.keMi5]ִ˚vY.k9d9.ss9s[9N8ΕvnS=Op<>ϊ|3;;+,-o2{[{2[p+f.Vc]!}£xx_]$ޭad|6/T_j;Encawho{B^U4wh\bzvѿm9}*Iqae8[9ao煕ΐ))p7-W:?/K܏ ØG+<_7-~' dRL4\c9,gL₰(q ]a ~?#gؗ}ؗ}ؗ}IaQM1ȼZb^Kky-1%$:U2.T߈ Ai&fҚ Ph*B[ZZԘAԘAԘAԨF%5*QIJjTRԨF%5*QIJjTRԨF%5*QIJjTRԨF%5*QIJjTRc5fPc5fPc5fPc5fP2* "N"^DxovR,M mZ0_KſTKſT-o["h1h1h1h1R~7w ی3n +~2e?,܂[1sp1ezcX7ezcX7ezcX/ebX/evQ2=ogUi5Vi~*ViVi6g=kYsϚ{ܳ5g=kYsϚ{ܳ5g=kYsϚ{ܳ5g=kYsϚ{ܳ5ўu^xoQOzhDQ"q~#rCvĵe*TRo@orC}(QֈF5e(kDY#QֈF5e(kDY#QֈF5e(kDY#QֈF5e(kDY#ʚXTf9o'=\UU@N$sE붿:<<,-r-r-UEU-jQUZTբUEU-jQUZTբUEU-jQUZTբUEU-jQUZTբU:>o?#w7if}Y^bbٙS/zԋ^|ćZ>a0q_X֨5*` XQ3yTˣZG1c4i8qL1c4i8qL1c4i8qLƣ1b1c,Xc1b1c,X\qc1zqvXF_՗jK"նNJtVYw\Ϻ+ Wy]S8G4 d{S}o@ Ⱦ7 dӷѯ<}2%siktmh[ǿ>v˦M74߱GB7]Mnvӵtk]ZG:ѵutk]ZG:ѵutk]ZG:ѵutS}rONɩ>9'T{7ݻMnwӽt{7ݻMnwӽt{7ݻMnwӽt.s& 7=mvJ,vI5yzXIl CCRL|_+fo {Rm-0"^M2 ,+C{m_Mlۂh|Wf `KLFd1J#BWȰ)yƱ!֧*C4ԧ~="C۫C{GR?e{ CaL U}ǯ lN=kBؔ^tKbJ58ֈUXc~w=R0+w.uX|/ͫ0\~oT ?:cm|Su UGT]CMT]C5QsC%Y*f`(k(F5l`+(o Q}`+(F> Qp G,XbYe)TR}(5D!J QjRCԚmJQRYJe)PojV =EkDoxLv9|^Lɢp_2ɉ"99,y@N<lT{]0,JJ̣Wz;չQx%m  U(]O2Sʱ~01Let:zGrpCrs{brdOo'?)G~GgYȵ9\õ9Lq9 %?k{['~*'Op8wۿ]BnH햼UАWd *KȒ9dNj᧸ ?=.{qA1Z[o7=0 {b/Nv~Tx鰺[C S~gK9y]qupʟSMөTt9մG~̘O'F5ğV7tn?Oe^jW+Yۥ*Uc*|EVu U*^V%ժV?)*q2bY3kUyb=ᯎ׬s;4-V%zVk5l{^^f>koEKͺUY߬7n7Mzv~ f,>cZN{iXl[l[e[6fl|V}gY+ت\ݎqOh[tg5[e5[÷-jYbZZ(rzd=i֔&+Or\ {z^[rW^WRkQZj[,­rȏW~<ūЖRzաQ.wa%UߣjU_t]SwPv9eˍjxnZ|Jml\yWuz^g3ͺ黺hιZGlAluFQl]QkuV]MkZuz]^kխխt6ݩMwjӝuzݩ^wzWWjӕڶuzݨM7jՍVsgҡtpi9.ku:ZݢC:tS jTVTT~FߨU|oT*^׫6ަT{joS\lPCw=ގG߫ FǪ*jzϳUf>֨ _xHEUAy1[1[e|Y>_lYyY>_ϗ͛鵈NdfZ-UdfzuO }j%74Q }޼/s7F{e^ܳ96CdE+^ ^Ȉ^dfͮ6]Ym2MfkFfk6fMԛlo4ٓ'=)I=4FmaOkOzZ5xZh1D!Obȓ'i1YOzzӞ߇ikMQÞءqG2q\5*tD1sÙF8n]Cbpwژ[YJ㼓oqgE[Kwu¾o:*#8|` B踃#.QTpcsCč5(:ÚTHhPt>kuU{O۽H|;rў6V m-oŀrlcY_og2ea5cXV'M w+ʷ,:sy svDw1`L42F_¸W(ce>@[JWJUF?Tkf ^6:GO#LjݟcY|FcY|V9UgY|V8n>泺 փUτJBg@Gg Cnp3ߡrgcP9G (<#e֜5`9Xs>V " 0&K00RUxM}[:6({A`?ώu~?&4Fg\/z)kn@_ȐXl,g63g~vFLK00[o;|?ZXalM avoOPp*\XXXX z Db@v;P2zqr!m/08gsָk/2\h#ha3L<;OZ)xg9x8xb#ёHvt ;Î氣9h;#2yXfj6ͮf+3e2 f+0^ux0ނxށ.BXŰ>yjgQK"Rdz= P AȐhr(Cw0Q |Fz7 S%sh= m/"PQGQx FHȂQ a ̕LEIs! y [! ڳl|MGc2}Ŀd_/jQǯ tN\y"鿈2 d????%H3d͠9zNHNHNZ1X2 x>k9)XBqrprprr899>d8PFrclR ȼ@}HAchMkk6}lG<9ļe987&ܘscrnas_aEQhaZ88u&-TH;IT\8%ՓK ӼE2oeüϏɘ9{OóBY(> g,P|BY(> g,P|BY(> g,P|BY(> g,QY')bL#+}-ʽ1j>qOܮMܡi29_Tvvoц)N+'irV"hQRyHI|%7oϤ3iu͑]rz˵i<}.?$mѾUr֐j&r<QGqf&Rg%"I5fV0(K>v˥~0 I`B,A2ԒEm*ť\$xa,`sUl\Cl-`V@>lW-5~>_k=h 'q}AtM>3?3?/"X KcXeVc3vw|~ZXa3l[A)CT#jAm V4&ΗE0X.2 s5XR. t3e~lw5p<ϧ|̄Y$! p|%qCSo'#@Ȁ` λy79&伛wE`"0^% Se `:̀0 fx*0O. ^/#tp#=!K~0ixy x/d/Ta:S.JN$X)g,0s9B!?;C?;C?;C?;C?;C?;C?;C?;C?;C?;C¥|89k5F#gN'NޙKޙKޙΓ޿ (?s*d}z{)]ve<]8k7uؓ.DJ^I\NzQ\*z%rw3mEWE[/Ҙa 3W[k+R4 MX]w".҄`@ Xdz%kw@sZܨi0c0FBl cD|9{9{9z9z9ywwv/Brz*`{I|!?Bݖ22ƵR̖D]ehlY>Uڝ-zk}e/o%҆˝Tq6M\D?;%~8W*:ZEsj4͡%=sz %~.jM\: cÞlji&JR2It(Q&R.(JA7=BO^ k/Q6]E+kkkȑkȑkȑkȑk}k賗,v'ZI1dhpRwB&s_/02`q黂Z7HU7H;BkuGrZLYpzP} Ĉ0 mv1U\=\ƊoǮlsr3g.,HFi[|uŵƝ482s=,cdaF։yfdwcz5kEn5nj4nj4Ŕ͘zIV3*jjKp'ƒp0NW1uw+ߨ_RO؇^|;jCGw{w1=HdzBIZVyD?y@vy'ðL.d/+]ĘJ/RJ\4Ֆ|1'3 a i9Bm>Švs⇋Y7`|ՌU'fLy;lV:1ڴRI+qZqi>@ ;G_5f|ՌU3jq')El-=c{|rO|[bVz%v;;#'1폍厦5q芍v/>Wk"W[trqE#\?_QJ؍+wKdӈDDTP\'%2Ȉ"GWHܮP?#[ˈ;<-I~V3۵Cs5k G:'+ ,:J^y'Wю_5rTc$nRyqJ2{%NZbaZeYCqrF\MFjAVA^[)Z)8HZ( eԎS[R81:'2nC|jҎpb`G8:Aʣe'|Z;'ɰ7 ldQZ>ʘsTiqhqR ϐ(?w"(Mw"~}i+ eO?x?yݙo,g| 7&ifhkּk};޵]C޶ڎ=!ߘГVsy+y;v{n(Uqݣ4_]JOe|*-y Z-e=;0dZ)` Ucm,|Vߝ][22憴ۘ4aW3w^ooj-j]u_o]Oծփ(^%^?ĊŊtdE: o$Š$3.J{Vޜ-(ג25m(זr(מr$27+Ms*QmWB˔>RFWS>2^rvrc:RR@==~;LSsvB5BXWֹI!Z?\&wɽ,s)K,er,w7Yͧb;w~U};SN;,XyғۊeYșu} #Nf[t1?Zh}rOz/$׋$֮hu:]9-{?6uMa{`vn} >~%:u+\4y&u<>{>~U;.EX{>wrp( !OO^{6Oērf~ϗ?k|veCK~LpƜ+uۉeN7DIwO.^-_@n9Mϕ'.Ӕ~W'Z~tru67y63x>y緶Gȷ=o6?B\yih﷪SNxX鿪s=d5vo;^/#ގc[NGoǓF9?q]T*~k};SUWy'{2Fߨ_sqvq{B S}DZ:ї'b6vT=޿g3y$Bɏ/Їz￑kXwGN<ڍDw*ijr)->8;GS䍉sUx7{r Xw' |/&Y/>F.sPEb#nE"PM=՛P[ WGՁjڪ-|uY52uR+ jZ-ƫRbjZPLZh-t.n1C+f9&]W|u}uO:~)6W׊\zոUhf. ;{N>(6DxxL#aL0&)~c1]I2f3ZlcRxŘ10)rViol4*gTn h;JHV S(M恖JfM2(pE M/p2,l98edJ92Gc`VpDp}2ͪm5T[Z*_Yj'JɵX5V+ʶRCzȯ+T;*CCM桶Jy}RԄ^SIAH@5O}xxb1S(,1'o;Dؓ߳'?S2=2oy㯊mFUoPWb'gl6Jm-~o[qXDYd3"5"-"-,2CV3K˳˺eHUE=GuhTw.쵩gM<{mk}^{ZO$Cݩ#c|HKŽS<;n%kwc|t3l@(v}y^Hb!S.EsB?D]׈QgLzrl@/K&-e4+1Vf3f0f2f1f3*#)l_s_Ӭ(y FIP2HFId11]l)q0q0M.~$Fd2-JM?n1/{ 4EA1q08Xa^<n'طzٌzNK\Vz[;dsSq0LF7tt:Bt8] :gRcV tys)/w.H2H M@::9l?Kn q܉F:d;Ý( 4\F=@Q(5}ٌz&<37ədg2m3Mr8h2DZoq>#Q^eF=?^^&^^6r~q~A)}2طg2)p 2ho@@`S??wqJFƑ`IW?kj2$3Yv![JI}5͠II@B##@T53ؑWI`G5Ԡ####RSSa? ʨ!Ho3M7\H?lw&{kwyh.KdiܬOE{뼍:w{x|7VzU;/yYto7^~>* ظF&fzL}Fj }^f$ˢҹم >>Cm{o뿈^>==1{*ow7L{}ʴ͡{]_w:^s=x-{M|J-=8+Pb}|ek#z05xh7|KA~כ:[xm}%F 9g=-tۚķ]-{ÂwP[pX]2NG}|ۿ}ze)K܋or\W;]g:C"޼,bw7N=͎X)?NRsw/y1_M-?5Gr%JYO@ߏ8_? T{ޫނDz/?|t(tw PޱwmL?'ds':ӭVj^RJw_ w7|ICq{i5d9:{0t2ս[+Qpr?&V'DPӻܛ&{֗{ých+Si7|yӎC]Guۃ~}>|(n׸x<8^տ{C,_';tn;W__{s a=䭈뎲lq{new۱]y{ݏgb;3G/s?}K嶬RmB\ǣ'i#t`Gu)'!nҒ9_ДٜCݻҾ~*^9=-{,ӌ 1IY?ߧ*N!s^lߔGwOIۇ|60e6 xo!82_D-yC?-9L̚5:$>Kp~}i w7k^ʛy0lm.F^m1{{%1jʔkηzװ.~?'$t\k8Yj%qwW_gy۽ ~YܤSi[Y[Xuj;u*?RY G2 #T߳*[MW~Vy'zEʋ ?WgܧH쿔XT4Vx0%f VHzͽē [B_cLZ_S9_n_ϖվwVtMd.Ԍ9NLM>R}rwü;;uw@{>^]=]øy'ԟܸ/$ktoֻ1Qxl{m*<&>b/.D轠(EtգVxQۍ:nW:F%̈ Vt jt4}F7Ba\i\IѣM}4ncc4o7 g0 _/f}U}U4_kh}|Yܬ+6kژvSf _G3w<:_Yf_<9MfomUo_@ ԞF`v`$cU_5T+̭jܧnVZY~_mPUIP#jdUUSfXU^SoXEIjZ`ToVcuB}auRK2,\j-808ۺ084#82uEh8ڐu! Y7RC֭p(jeݑDI5ǗDdP ^&b(cQ&r6FAr>asRC(׈bLbRܼ5^DRK  FZS_*mxU~tZ*2F ᰑ m̭ Muz7# ,b,n,  ˍ`KPc(Bc(55F1j7bnĨ~<`;5ޥ{GTl| 4/a4@&tɘ̘.ӓOfL?1cz,Uty&fssAXcXr*Sπ1~uྡྷf_ѿm&3,ofFc$ jC1JE8Zb@0[c$h֧֧էէ30N  ^20Z$k5NXc)gM"k52)eʹ^l(Q5 Bz\!d;Z)v 5ң ctLKKj/P^Jl:+Yif{\{*kc(doTL?aoD[(jo =Vʴw;eBvۻџ__ =janIAiҔ RPd@ȔJ*ʔA!`+P6]VBLlTQ1&AP]V} Y5eוu)C֓/%se.d O@<Fɗ(X6&G\T6,es5˖dV-,vS)sGy>Wgy6P^%{KeOK^M-5zj%{˾h&y3HMvy;z_ށ2PB=`0DA w;) wݰGރV(9JƚPx+R'q8r5wr\h8'P䡆FN#X;i4#щ)rVs9식b-qJЖ)`hD3A3A3A3A3A3A3A3QL֜ h΄<8kDYL-mR`NЀ9 ̉ 5s`N^n/* BY(`9z CCTpGx5 g;}ݧ33tfZЀi_3-H0-H0-H0-Mt݆V~qA=`]YG>40\jFy>Ϗ |}ɾd*RIQ/ݗN}|Wٗ}/ |پlj G|Eq4An<zn n n n n n n n n n nG~$p.Jls?ߍ5^4'!<l`k l:Y@jݠY !!/PPTuWݩP]H)"uUQD]B9__dr{z ulVW#ju^MGoT})fy [CPwPD TNu',Rwš~hQ38(ZFA>h5}Ƣq1W~ 9AMщj"V$+sFՓIjR"?]M 5G_P/@R/RzI/Wp5:Ss\hPo@ zjyGK{=XG+OT}:QrZk]Vjj*K^֩uT[se+H];o y(]SE6OC>MOS$4tͧ)̮%v̧38o.e̚|B̌Oefܞq*3әWff8qV=6q9~{l=69~O=6I=6I=69t=i s&{:ql0xs2GϢ&F z30T\qq>77z=o2n)P*׌)j .>Z*6f pTs, `yd2 7odߧw`# Ya(# pJa(9YO}Bkk^^_ ^uk2#->k.^M|.>Kj(*+WՐ:Q.Gu'BQlԱb٨QlA^7%~ېQ=b/:QOxG9a uܣZmG90$7dޟϼyg3lF쿡YCfyf=f.d#15'ff3j`!b ͓̓P'p6{'p6{4'P*3Lfafͬ`R1fߦ\L&c2%qL4ԉ= L(?$|>>@ٿ?,%3 f2dƟeoCjNߎ9Ü>9};BJpzټl>Y{;3TfY1/wg2/o.W6#SKYBY{1 snyT[2>uḙ3[g1{Βpp`=1c.h5cnŒ 'Gj\(+3W3W.O3̒0?.WPJBf]_G9a͘+ȅ5W.df܌Yr 6sbfɭ%2K.aܒYr[fMJG5?3&r ͘1?"}`33.3@^s̉[9՜Ԛqf23>yp+2n<84uBjܖp$$ԩ#%q,1c%q$"fs1?G;Ev:;Ѻ%fs,$"ցqNE,es1E(bIE,\$"(bIE,E,墈E,E,es1%qrQl"Q:q1?,Ò8~:fs$fs$fs0%q0㇝:p4v;ua8~X69~Xv&T.~ò9~ &ԤV쟴vkqwS37m<7/ncjK[6>Lh=Tj;=6ggR#<¹8OJ#1j <ЖpB ns{#JD'@3O"m=bAAHe?}JSN;ѝTw*ZNvuuyJa; ex>w[<yNaݎSqi'>OyZSN!{;EpPKpڰs2{8mT˄eL>LGH{ r E*Kwwh._J-W u {{CԱR8] Ǣı*q,EžɾYp N E-QWTgcé/B0ه.SM]S~K5Xcx7ѾJuuj d>'uR겗R[=OGh6qM'5?{&3i&ɐSTHgY= Ϥ<^ͤJ'et?uA bZh ?-5+H2*W?\QF7141CGS^5>1.077nɸd 1nZHc8c0T.0Y009pkf1Wj^l^c6XOO$]dͯivf< 6xܶ-kU;==zɲd;yoG]e""{>*&M9^ȉ)^ϩrHt"q82G+r\#}/h&_vq>1;(FU .DrZ9׈7Qb2ƛAflf89gL,p;f̶_2kC{B{dZMހin}D݈T)T!RRRKvH#uF:"ːBM"r3'$"C" #H!MBz 9^G0чD]:$Qf:>F$a17(wBJE>LO1<z }^"&R1RkSDꚰg{^SmEoE.}H7:Y㑦 =8>3qD ݛH|yg] "DKp֑{h{},);u9_v*R-\|fH-,Xr>[߻B;#K =[>]tw>'ηu__! J{dž#RZp>f,[@ >{ ARGdž'ggf~Y~Q H}tyxMxCxsx[x7d<"VITf|DBD [FAs /Uޑ#!DB>yRL<y.Ru#FDVDEcvߢj2 Sh z<Eha8:zjhh%ўDDoeyG}S@j̄>._΍}7q2ROȭѝѽ1sY 9 Y+ k"֦Lu"v]o_lPX?][lxB3*6Lj̈́شج`Ė$M6׶Ʊ %eEmlk6ܶA.ImMbKdkNd;M/5NyۥKz|^lm7m om#v>T`g@Xd7=f]Ws=m)b?'ggO1SBbj{u_{}}->tyn}fq?-go۲~0mwn{}>h11Q(v6r$YTLǜ-ʉU$d;{Î6qGlQMbǹUGcqթr9Np; 'pR49e>gętV8;gx9׹ȹI%GU5΍έ w_v.^`AJgyyW&.qhrXQ]']gFO*vu]vu.IWۮ>kx[rkWcJxwa8Ptm+jv{!wuOu3s6vW&v/u//^ssopovo{{}}}>KQ:sWD%QC'hg'SQMqx|9:LT[^;bQHEyR\5x-^WI7zyӴ')Τu]X6]L/&[C氷޵zSwmn>.o{{{^znuw;|Z}c|M+> 龬oooL7|+㫴NF|K}}+}uu>;|;-3|{|;}&yywﲹaq,Pf]]7Oo-+lY?R:ow})>ğWKs-<;"qӚ*+H*KNww-v i'z.{7wE;9F cECbZpuLdAG|ff扸"04 %8Pm$kZ((6(>g 4XċOa5p,pR3@;p9@>|`K8TPb  ^`A8h- W`pjp&ΦzJ`Up < 77ۃ;{`Glæ`1x#84ievH ;B.d 9t!_(J*BCBsC աEВв }ghRhMh}hchkhGhWho)tj1 C'BCKе\vp.tJVh$G O aKإ2wp,O&z^xaxq:\  ׇ7»Cp@=nʹ鈜"|9Y^x# SEo}D*5F8)G[ׯ`IHHID\+̼ϊ32ye.E$DPޔq#iw`d%鯋lll/]4XE?7r r0i7tDFE.DD|0܎yDF󣅔SSfMQGGY3eОY:I%Z!0:=JqtB, r^Kˢ+r*s51dUtktGtWt{Mуcіh;eFODOG;E=%T9S5>p8?^//Qu"ooo7?#sV-W̑8wPvB3M5„.aJ8>`DRVĬ\g%$%$%VN'V%$'6&&v$v%6%&ZLO$N': /'z‹7Ëś)WG+P^Tn(tdwߢu/..)-_]z||[y|wb,okHt!%+?Y~l_ywX_|~RW%1ɂdqҘ%=P2&&g6%ċ-YJ.M.OL%%7$7''w&$mɎdFr(y;J;RcS)]r~M)G!KERTEjzbIjVjnjAjQjIjYjEjUjMj}jcjkjGjWjo)u0jON:SSSS=Mk멛bRR#i%=:=q =!]6-ia Kӓ3ҳ }F˸bKQ:]CX^^OoJoK7wK\K7[ ''LIwӗӽ@zPHmfLf| S1flݖ eÙlfjffz 3GTQ2K33+3uuΖ̆de@fgfO|"sܙ9itdfe.ddfS3PvVetٱlaV5eY_6Mf+ӳKs"...ˮȮʮ%Fd1ƤJw:X_+]ٽg8ݘm!#x1G$==mg\uٞ5ggofoZ-@3je;шfoOd5BWؒA~VI~~*@t~_G2MNxèw^ '@˖ͫ@ ,n_=DoKK 8y`k<ћaCt zU̝Z?};]h7Ul?hhtCkXao5O$oBFFhkmv_ J#$NgCr1jXFKT3j?&;苌ot&A`zTeT= <9>9Oaa SS?ƪRUVA.a ,Q@3ڠd[!]=4$8sQM-KCvDӼTHQGї2l( {[`{F(8q l /8G1(z]D&0GU5v^>?N1SG XGT*ϣ#*uiANA7 Tߏo}( ɏ5g\(?ּ ˠk@׀~ c6siyhx?~|~[O! ݷ'78#t3A6`"J{__O^}^ס G00BTLsа>B}C/h "7yVа;emodC^ڂ^#Y<Wy h? {suAȣY3<8Yq`^@Vw, #z b>(2P)-J k%2jhg3Ob~o=j ``v|rFBA8U[FQ#gCߏ̷:(Ȳ!)E"Ӽ:D FY96+/0 ?\j+ -M597MZ OC/W4C~elY|>'K {ZaV\~?0rPBH9S Qa1͕[ 8/0{`?Gܴxb_}~Щ@3LŸOZQuS{w o:hxꠡUR'snl32>$uzhXF]]*G>5#_hiLf|>8wFM];fG͇Y8 йed^ uY,?j"l1,ɇ !~"z2۰!8Mͨ čHbxݚBQ RECTo,^1QQSan(jCn%Pd"m_"zG:QB^#+d>A d5 #i^ll3Fy<V"t!l@腸wj!-rkϑnDj㊍*P,a /)eI*Z mq =+V vr,#J7(;Y^NˆX)eW%T?1-jAÆd>UTPi<yDƅ9`v<ۦa.Cc+hH6. AO=̃ɰ>`A/D2G< Y"1pi)Ե 417&p8WhĽ=)x 5r"f+r3suX5ODki?!`wvQx.ڱZfrAЋ]Ů3CҰ$W3` ?Dmp'mBC95ȽJIQguJTA5֠w0^~Bf?8;}a DS*X9i1WE;|o+NN NQ;M ?av01TDլY5< c14AWE ~ F 4bDkQm9koܷ!FJo>;lK[ uu zB5TepKV2|`Tqw6-[c'0=:YBd ~˨>Ld߁K BDD>爦jRu ȼANd!+^j5U ?5j8r'>% ~ 8J.~M~Ͷ8YQy8?7j˭2stn_'j}Vmeo?wDC)X=aUVQ|)[k#2 WXr?Wh|Ĺ#*2]"+'sv+= |xc 戓]) Z֮;SHO-g(ne?ӘJIzXFuȼVJJ!3{QP|U 32 &FP'!wT%f#jX oSjPYUI VZ[w2 c$QGU ž=*OO2- m^v4l*Vٜٜ ٜ*,rL:ŻB5Q4DlS$چQߴ4 mD?H{ _T/1(6`vsx98 m -|D\Pe{VTg}d/ @J|-mOa֏c֨.3E_*qxv/ۉy=Ex{2qA7"X&n1q2Q |G5nlt,MPT:T]UUTTQ'WE5jz mPkj uBT;_EKs- $UJUԶxu:iY.H&:9tE*K7!鶬r\(d}Ґw_#Up Zj]E)44juh/~%$rD8"Y|WUhre:y MvA~U De*b){Ȝ&ocE7?KC Z _iH@*"%bRBJJ҃C7oJbiBzVZ%='}E F>#қQIM޿(} }(}$ݔ>nIFh ԲBOV%*(KhMrlgH^(?&Wʋ*[R3rrF~^^+?7ʛ@GyU~'˗o&3C!r1 \DJ#FDH1)4b<#H#s#79CfCjzX=TT\}Sv~=;==םнc|[ORjPR]j:[#:_-TˀbQ=PjKZOoWfu_mCjڣS{j?ꐦinҜR\Mզk#ih SmVjZLMZ(.Bziqlkhe.R5L6l1A @#_3(/r\`#W!SaN8Ι?װ0O]ːk),o >S׿~R Kj hSR5TE.HzLLp+`pEL͍p'kS=֡`a?YY0\`Jw;`(Sefs(=:EȻK|II[Zh^B1^DMJD4Ehjmy0ZEkM)JAEhaa7ڛbowڻ=>(>j Og {u؃uVrە3ddg3;#/c~Fab²b`eFYF*ƌM{3n8q,38ћq9?*p#c(AKxn[йN N%%ss,. . .`Tצ&X{_ln  P8/ ^p-x37d",`rh0#4 EЊЪP m m'n`Oh_`. wl}RJh0t} n9rct@Dg83?s;b˜J̩pƀmT68uNx_49wF9ໝ\vQh\uns( aw ;xjԻ0=;;'./ / /gIt 51 o 7n)xWJ>>AT?22GR59&> :/ _$Bk?'|@x@_ZWkͼo|$$"Fr>GID"#"3"7y̍c9- (4R5"ddu2.fvj3ȖȶvGFڹ/"G#'wMdtlBRJd0r=r+Ste3Q_)%aD'~9ϙّ̜l2gf.}gdM#iv{ N7f.,e,K3i0/mˬȬbYf5;%xnb_ 1ɽ%AmǮܐW%222{$Sʻ>)YO ~,e s#>= ͙{3gAN#p̞s1i uKSfC싢Zԍu\IHsZbY[ו/ͨG'Eg}Zo(N 0$}8!Z-G ߽|WtIyu3:'~8wuO5ơT_1#S!3p~!5#go>D[ϊvD'/Ѯy1:wD/Fp ^ތ&g?u1;=:[[[+U6<&%Lpgؒ6Ylsl Kȹ.yK@ #lcm|މIg}n9;HS1,;G^E^w?AsI.}i~X1v:(~KؗTL 4_f,>X/.#Ïr۠;ֻ){9tQsJiؕ\ۮb}_@k:iFF)oCmXx%vF G*bʅ0 W| `ѱGExxu3Q7c&DGQ :f<ڨ;ГГ0xebb?M_PA^HFą.5P!ʂcC}ga0a4F=[? PP A&9l;[cjXFMè`gxQO]cuxT]x# xkZA'2xVVktҠc`Ef R}]81^cұț tGأu4>MGtMéI&tLe,c-"N8BCcꘁϠ3{!E{K]::5ʂ6M✀q1ĸ5Ž` :]]GR/ѷ:Ί:ΊͰD_i 2-oNm|,,z 6BY_GY_[ rt9o o9c΋[:u =n,R>|:+ҭww1FnL1wt9nOFnt?3vO7N;S}y3T/QD3Y")\u@ERH]RWTFuEFuحQvL zZzET4Esi~-H\TMѲfky|p$)bmVdЪjۀzRGOP*C|KQ|eOđܯX-,wjz-Ԙ5nJȧ~]U)-AX{.Er 3Ciwpf2-ܠqpfh߲Q[ؚvZrhn :н:l[?h2 ,Uay 7D߰ 7KkD M}i%Y}5J->G.\rV =~Uk*~i,YS\' vmwq{Q$vd:]%:GW 8)jb0Z2|/N3~ |1 9h?OnA? |6lSӓ=멕iV’qwgW2Q*؞:u.S)=LgTzC`=p4p`ғNzo %?F%.K \doF!0e){j EVkbMqCOyzOr'YVw̚OJ , odz#bk=)VXcY@QȪp7yymVԪ6Zu4٧ӞX/hY"%4b:ZV{~eYVYSeߺ)nrk(],'%JOy(ݝn;ISsv+s=<} )OO"}+ }9Q)͑A+SM/I/M_NВ^&}zzMzm;k3sIzKz+ifJK?ޕ~*o]ӘFcj9Nΐ;6q%DO7$^o!A-T}uwykO[4k@_f.Eטw}wC5~^ߘ@t&~'aM-j h6hpM ~.U ^H:ЮY%NF[v-]Ь5G^mxzt'j~!ϣ>!i"o`DԳBYb _&vԧQ-V9T (\s mgI%\NS=w{~\:5,ׇ Y6$S7ZTIt!omH΅8SYNԭ܋9Z4M̟GFD̻#Lӊ\rEysty,a盺 6WSzM|X#UB}1𥬩^G7  ?wC>?3g ygJ1"7Ewfk 09z5d,̐czy:O\˘9=yZsZq<Z Yff5=6yXgh#$fešy :S1~z.9,F?Oqx.o[ }K4- 3 >D@\7kkX ) u>iw ߘ؁^5Ʌ]m֑.jV*ᇉ_Ng=M#ܮcbS/C/d2v{Ax: 흏n<d<[o(g"EW'W{aWV* %6JlOl!l;%v'JK8!?ON.K+Au- @F!? ?Qq0eQȹO& %K,OV2 B}AN^Q~n'4 {~B}ఴqL= =(LW 7(4-8gAH>~D: 9 P~.!,'RY~XCX;*(Ԏλ@*?wK} -㠕p`ߝoRq{ĿGrk}t*gӈ?I+9<ry"0 |/kBm $$ 6dKHʲGsh2ahoh,m2Bs  K Ed'{X{J?U? ^Rk8=%9N 7ɺOE{ڶQ*S~ޗw=)k_fwS;{`~7|q?#Dm Z`v3E]Q. 5a~ e$B~Ǭ*_k+!Bɔb\:+]>VFhP滗Iy<DI ޭ{ӆQ'S}e}GC"}BlgG2YQ<84ctpx̡yd989ҟslG;trLerYTeyȩ3/OζQؒ6P*/G3lcN!%lO/mN奠p> ٯcuI4`($heUι+U&ɨϩ;g,ΩNEI=YkgO#~lXW.uI/ӹ)Lg0ם9aZa:߄\NҏQ#^iM4:D̟I<sM4R.}n4>m"tݙ#|dЉ2D U()bD$Aqg5Qf,1e"LĎ1)&bD\C<_"KF{/ۅ%bDQZ"2KDc8,{%i%bDtU"EDQ;"rJL!nEI)%d<½Y$dēuQNoM"IF38&q;}%DT1J+dDBB<1G"HD"U$D$qC"bH (!"&HD8 $cDԏ1>2G1CDwdbvD<7"RO Fט-cjM#hDQ3"^FF OE\02 /"ED"YD$ n"bRD4C("DDxc"KD\($bՠD䈈 Q!2 25rE&]!b:D48DݐQ1":CeȈ  y!c.D_@@T"BFO nBFLX Y)#Pb"#(dFMD7 bd1 2ZAXQ "AD"}q c {"@DM DQ"F@F .@FXo&n;򶿸/<書//ƾ/n+~e=hJLAQwRFfj.ŭ4l-Cka-XZ\d*Am~ўӞS"z %Ӭ2ĬIփkUUf|`=c=cQ^*VnP˴N$L!dr y) ńebJBPE&l  &B3a~B0M!#.2!Ԅt,Y~Im0B0IG>-d9|Bac. %R)/'!vB-aBhR>sב8pppp'G3>}qpS>Iyb&}'ƲWa"rIʺLWF}ئw{}A]?O~Eԯ[b 4DcmPh,(+ eFQeTvN?mvh66q4k\6 cLi7'Sf97 ̅sYbs-5fl0;]f 0eҷgd:Oi<">sFM.R)E\Yɮi,\EM<1>^-gwP$/{w8'r//>~ ~ g;ͅc&SQxpN tro'wJ?KVЯ@lыE飨xЮQrsx ׋| y? I:IXKGM53:eDs5BlXt&35@MBD:` ?M :wq/*?3D%ڄ?*1䕐<οB0E< ſ@v^B+Lۿ7//&AWχo|`k'6CU4biW yt&4gEQg ^GC>ri ɷa'Fιs)F9kYGJ VzªjX_[߰6ZO[CC ?!(3蔧fKr$?["OvmN|*|L-+>RU)enQm/P\Q눨ez]Uz;raA5x<7 q&ϫ?#7/?(Ef׀4 "~am!5saL*~{`y>`y\E,j(mt]bwدGcq%^5|jzi '~ˮ~e;wOA^ qi-igyA_ zovvz8WTQ TQrXT/#+Wڏ ww_De~ t W@@ׁ~ u}twA>vfA[A_=A1U>hcT&{ZR +IW81$k@,[|W!Y+[ɒ'e[:$eYR-F[e0]G͛@Cw>Af=h -pRկaa{z{WET/"""H "" "AA^""""b " r ""1HtEXE%h!~h|_ kNǩSNꪮb.'|6.ğ'4YAX*Ѝ+ЋLRIdv>Mx}pOfg CN# tGf6cC8>O_@4B{g  YJ"}VT H819O. |:䊄KBNHTBoX(+qrm B3ʋ W$*;Zd* gUpYklﲆiAgNODwpopoЂee>sg-YC\r~WlA_.&IŰR.<ӑ+,0L9Db.w{v^1}|ZraA:|XC}K]B [KyWe[asx*]egJ t`G ğӾ/#'0RUWLW+ڊ*J㪌+rr& ~gRVg5BW({UlUotUf>vc\{ S77O6dZRiO1B q0v?EB{06WX`hhϰf| `K#Ŗr_ ^Au/їkEcv_g R_cC!"#\ne Pv {oo#a r4#,v] t}=)e߅t0㈸}}7RX`ߋr&QNɰL3ŞSA4{Rx~O;qpG!gt-t/cZמFOHp0>K@RPGz~K*"yjE^Zuy].؍ב^G1yH^G@rx=>oԞԱDYu#gg/_6%w|'ߣ{==SRSآ Xh僓7A*Gb,= e2q49rG D!\CDs h/:#n3A/N-~'(`h~Z}Qiݛ6ZS_HDĻE)h7 K;ڗ׈| қr=j=h|o4lLp8t}pQ; 5<^65~)N^@,z N9Nu'il}P_/WkuF=C}=6y¦cF}4hi1.h#@cXHc1ޘhL639|cQb&cifYLf=lb67[Ϙmf'c`6̱}#s9|2Rs!טVu_[gg#"D,+=ԍ7f|+]%rZqYeM]{wcKGw=㟽 D2blHKRm[yTKzLD@Bigh3}~M=7¡!Oϐ_!P;x=C؋c>YGx g b>KVXyZ+wB_j AzM}o=>wAEHsG%ɯܷ +aoo0;Ӈq5>ECq?g.estلN:hÐ)M|Hm?w\P{i;=}4~Im+c ckB'sC«迕Z]K4 cN7ڝkWj|^P =H;d(jYk%Dl!d^ b}ŹV8%ygl NH99Z373=!w j)SָDB!VПrM>lFpͲ?ۧڍf9vs\Srrkǰi4S9 k*(R\O$*v3BOj$ai:Q徏!i˟p-lVX*|) =l ZJP֚=![Zszؤu:;KʴfӮK"MAmZȑžr*ۇu)l͇&UƻWP"MJNTm*imSL*B>ksґ)L:Esǂb{)LM=$55CTS9К{jjn%FUSx~ccW77lt4Z:-|Z:hԡSHK'IKǥSLK몛wyZeVϹȯn`lbfn}>nenc畓V#6 fKM޹?e(EM5+jf):RZzkbW_HIn1O,;8&0VV97hYeNz6jaʡ9K*ԾDžeP~{CKk|eEp8s:x̭&̭6fO=,#D+fr)jiWm7!U[\Mzo%p\t]1C!_Sʂޢ!yQi'u ϭkخ.̩GNK_^{s{s{2/3_ s3 kEOro#&Y̧%s:y]ձ޵K\u{({Zikzi==qcqn4M-gycHx7û<ύg!hs`ilyp5י>V*+eՅ4j X;#`p@kHD 9ݚí kUWV[oY6b}d}b}n0Y;#8iF#" kR>Hskd\HHHHH ;r_dJdܬ'Ep"+#k"D6D6mqd{ȷp\Gcp6D=e=1z \#`M-pF[D;Xݢ͇S.:n(}ttUGIip*yp ?/X;?kɐэmD~{I8OE v<'/W7/e~W?LU^SzXJy.$(kSLwpy%<-k Owdz ]vrV>^9/_.;.yOIyD3x<ũܿHq S^%>'AsapQRӜ,˟?cw̟x2 zbd)ePg8-WJ_mN>,h<_=Z/!#yNS5܅$c%'DL3&ץj}䊋 E.wJ/X\ç8nS(sx<[CW~(YT=-\;L9Χ\'OSG:FE:ױSSӉ|'[9{N0ED]uP\Gd_JW{Gi$|՚",k\u<8g5smu5O Q+CoZIP5\jZ&RךZ7Hȕ?j^[a0pm_~̀ɕ!ZݱOYS&W\Q'ب!72$ynpENYr+v$ͫ*IU$at 1K+7@h&blˏ9V>Fiq=QzD@mΩ,EMJlK>>vh;u]IX7Mz+^w{}}>J߭Wӧ3Y}T_D5;}UX߮K24fӆ7bmxFXD7%pF 5i7.4:H<ie\g *6F%In1AŘdLRjg)CÓ ӗyjv:7 ϝx v{R0 X _)w1xƔI7J_ŝ D&~SSiLMУ8s w^:Wt/p0oIFBB;Ĩ] 'TꌯE 9>,?wE2?JD&wE2XĹc~r/p/",Rgi< ]te'I>WBj/%Թ㑡F.JO2~`:w1s=K;2d?v#v[S!vv{ fÍ4 PLyP7Q^%'P'Z𮇻.L=jh"gvVVG+;ѳߤKgߧ+wx G6]:YLG:?^{ix_{dEu]ZԾY\D4wcJs'AIs_:KPuiZ!S(i;kJ Uza_YyB:P -FBNjxrO^& fUqd7e.MmYFWֈ><;VN{ql^%Ṛ q 5j4OPLsoiez;M*D@srI0q(mК|qbF]U;"EǞ`vQ%U*Ažb_SIUbb_xP;2܅ *2*B+@YXOw zyjᜬNuRȝX'n6."%C;whYfp"~ݲ2^6jL]Ql۰.ܓR\ioiړiZe1Z҇6 Nʿ. YFM[P}?9gHbP'ϔ>`@0 )Zk.ype6qM &).fhzh0<v$hM[泇341p]\s޴w(hTY ϥ;].( t^.=3qǕ?/$t "LW9:yNy/;f\ 8(CC (5xŁ@aB;~[uwNwpfvfl9ZУE(1cK|W&Ub#9O':%Ll@) dR&Lv~U"?'y[c>OIN|( O'X"ŀ/%WJƓL"w,Y$uOwOԹI>Vրm\ԙEw^^ x{{^"ވ^Bw`w0~#]>-lw(p_tBw*Wo_YFw~&^4xm=u:e]+{ƻp )^-EQ[>R4SEA}PUEW Z555kSkץ։Z76nLmܔ(DK}H>N} iS(~'`g3`(]EG+x:__o";;.zl7Woy?m+a3ZJZm%^E WFeaa][ K:\.v/b6,\$.G]Q7K&*,t!L靹iK:ch9 ZNQ&"vs&ˠ+7t6%98-tK_~ 6gnDZZg8Cf3M0 ~3Og~&󳘟t1?KARGSCA󋲅/-bEآbl9&@k׋%G`VȖ0:B+['k,\B0U, B%ʶ u[p[LABZn\xKd*K:e|^^n[|U ۃY*[y+h)ZfSP(>301A[hhW96[V/w/G֤]+Ѧ!%q^J$Բ2/5x"-4U k2]ڟ=к9Il78L>VLsA>pi;yLg&9>˙X:GZI9RDh1Iyȣ}}}ɧ}*3Eɩɩ1&ӓӁ?|3` g_>u&]{܉0eɴ Wj]Z#.z>7?m]QQQQQQQQz3A (vG#ee}*;;HNen+i ` azZ6/6/Eyy|1xSǫB /<?k<0z?kg,>2 K~]""v/.kXxGZgww)e;{rXj++wJn^Wy= >ހ~ >޵`{}yV ޫyV M\ O7xkx6nYmgqgqgqڀ i,  XH6`!mB i, XH/F/F// h~)Zjт3oV1Dm,_kkNm&,|si!- iU h1o˷3< )@ sw@eKF9C@㼋V#Dn>k'ILD[x41}!qзO1Ι1(xur[r{Sb]ЦФh]7mmt kKYeo=d#,*-ZSt۷QQQ{Qw臨>N}:ꄺF>ȿɿٿE#M8uTLt({r*T^~' OXW4(ǯ(7CL)M&ff9qb8r#K=oS,j;9'sS_xmrpss4'89-IN+g'EN;qsAtt~!Nw:;}NO[ګ닆B OR'7ro/ܫQ'Vȭ:ٲq ''NM4L4J4ζ;}}苢/*?E;vT Ʋ˩+3tRL"X88 hOM 06N4lWwxzjOO h ;FJФԢroH}!'9 D rȇl}'tS*V*J5A,!q„01^m )} Q§/6$1%RsHJ}Z^]6#WLզzrZ g{[IӅ{+G˞"Nd˖볒vSɿ]oA"Sl<I)a11̹XQo}43wqApmRƋ>O}ڙ |7HvEU#ckL]#g~ /C_ɾSFC= HC2i )Kњi уSG)-3IE:w+yg~=YRj Ǎ<Տ)>9xߟw"-4FOQϙd@dH:pԿ>2 =sYR )ʧwaF33e2ӏD=jy X^#co)sxG;C uޒL ~My_غio<{2*a!i]`?pQZSpǗ#{Z4nTP`80JZt*0,9ѹoq}\,._.X] Z`l6Gw{aR<4㾿9z 8FϿm̉^)DFpw"iw}[v:~8qf~8)BX"_: r?V"zgm`iq9# ;'@t:]5+ǰ̷8b"X.|wl VJb*VKb󠯉z[6 @#Pk˲ByZCTLp uz\MB G8`n0|z,fYspqE NVk9 Zگ2$tnw/phv7i.WȯɸćŇ݀|t|l|0P'E@1K,߀^__ Ho;;GN+~-ޙO tN\KB ɗ{`IZV$4hPy:m|&SҲܴ|JK[J[VJMGٗ 55JCO;vakک3i^@x9;xJnZmP I>Ly>gsEӗ+>}4߁ON?~Eq%ELD$l"Ma9~%{g5ᾫ `M_6%z!mr߆vKL~'!^ӎ&rp/US=֨ /MЮ8Q 9QX(OT&JXy5zM<ކxk;k|;kIK$'N&B~B2Dae2DFf=#,Vede˘l͘2g2YY¨9]\,s,xߘ3e|H-7cv`SǸH"kh`k\OY~E՟J~Oz~wS~>ajʨ ޫԘ< Hr:5:d˹EdX 5,K(5)Jj̢K̓_"oP3R-E_5Njjn#;Ο^ɧ#Zƚ,箿:SּMIaX̦=Laysϰ'Q+4*{ 5 7ͰS?\)ǴQ.yI6̥\Iy>OSʇ"{R5%~7)OQ?C(ŔJQCOx_2R(dCv"-EʏQ.>Mʧ)AK %V/ReG]jv=f_ϳ[)C9~Brϐ|XS[z2^Rf^9 s_S>/V!e-Eo]/[QZcLRdk'1@M#g?HN40_ՙȹ2PN?06rޢ.c^1sVȗRˌgop+>rWoyɼd(0ZY&jR +s P~XF%f܍LGa?z3~/O梇LYR2JsH6 >Yaɒ Ҿ畠ORZlO 5_L(Cپ ')ٗyIjԞCcHۥ?2f䝘?[Fȟ IފQf{i ͦ櫔(ɑxI;)}-UOheOg,1XC UܒL dO ~n)ϭުJtaPp$Fɯ{`Xf[yy L=zDx8DZoCmo:߳u!~;|OIC~a iK~hϑqD賡FQġo>qO-~{i3 ^#W"W#K ^ cHtȈF0FcG'D'3h'3| hA(@y 7V3\bg%u9r|CzE@1dp0&D7&uB?7ѕ:NGʩ @49= p44iEx*Tg8Ês&Ӆv;3sts4sتU@-P`uVv#z眏3>=29ydst#쉬@"Q7I~^籔Xȇ 1|PO M Mb3cbsbsآbKc+bckcbc[bcͱݱ b'bcgcccWbWcIp7pGvǺ49 "-un[.wWk:wpw- xA{=鶹n9AW`ECӀ"P pZ\ ;@VnNq'Tn'p,õ,2?)>!?xʹY jDZ25e;TT}kY{R'n~C"@DzHP\8-RUF$K /+/޺%s#Wq%˲hrWWQWx'*kFod]Ȼv W>j|֧ɇQrH-\Ej*R\=|J%ۓkD z;4\%~-ZV.J>.;Q?S'ߥ{\;VwSSbeABF ~B:FV=WER:y+J1d4lzV9j2_ߒ]{U<{G{of,]#(?*Pnޯ'~}\+w`MM +VeQ.qYMB,vϢK%Pܕykv-.nq+=>/(~0 qWeos5eɇoX,5kp|JWxοwO_<ܸwQ;V*v|2k{3 V\>WW\lK2Gݔ|>Yoej%?Ƹ56/{H>Vا~V{UScKQúj(5luҘ(ea'^a9eg 1&̵5/?IRQqk5 rnsi?(;1)cI.J/(dJiߛD H[kJ)k+gZh}=2oЭvnB͕֩:^_c{|eh ESJdlo꟢ދ>|S&L'%Or]c doRv^ԗ{eARx ͽjaZnjW.c\gKv?(+}^Gg_c 3dU1pz5n򡰪i}gwqmIM c]nS\cHVԕ.e6o2RfpԤlf e3l=R63Gf#e*RJ9 )R6$v)J*)J*)l0RBmgTq~1j@k"RN 9s2&p/hι(cÔt^N8bSkuݝ/Hoȷ%P!%o%{2F)NFu3ʗ2Z2~|_,;"CH*J7@MrK>Xw3uA.]d<mZavسY {:{XUdTrV>5;['9 kD6⃍Gr%عv>QRzqƺ@JV,yv_R+^=O'Mʳ9`ͳ=KMgڋJ^ĮA|.WׂP _e/[kC Vg{$F{mm;hmkѿ: vZ+M`[GwmU``%v.TZP nTYϊ~] }|@vi%[q0WZ.K&{i&)Y!UI)oĘX˔w`6unFMK=w qV@݆tsXϞ5{:i:ַ6%l âu# 0# (wv#YjY6/_ XkœZy.[aU V5bȫ*FhkkZ﵂Ut\XnmWZҳkm* kYӺIolcDn"xFo1xRk=”Ěa'`sl;dkyl6-f5XYwz)cmd;0nk0ցmGM7W!..fn ̟reʜq?s v0Xd.ص2oٸG+Ы/v0}e *2Wq~^HVRf`ؖ Vˌ[i3\|ZGVoްVJj1.e-JexvZ-^d^[ifZwEJቾUUX(d<5yA-K#_|jf44R?KR /#OȸKVvElµ~*X[KyN{5 OxƬ̐U^ (yj/RLYq/X(=PjL0߲z3'o/P?YN}hy@I:~:_ |,̋7;Fo>MDӼ'+[}?{c_9VV{KfhV-;Z%g'_LS>ΔkʁuwWtV#oVRX6\w*miMV)Vlʳur@>Rz1RV7SqQz]IyymE?Tϛz߷X`Dq*d]c-VGzmy [ge-sR~GlSz%y~_.%QfUXZH Az;y^OʖDv?賄o/{z S^%N)+*N3MIײ )|3mt\4KyX/o 򶿾>__p|ΐ٦q?$tf'53F9Ge-!9Ge 앳:2I!KYJ[Jn=-Z,mS-k<=]2'I]ԿK42ʔ2ʠ5F4ʓ|2Rq*Gz$(C03N9;qeāA.3v8K#U%EFQBYW~EZAo|XCZߗE<=EFS5} d-NB5b溺zk=/5K?G C8C,U8嚌d* w!JFz8TF:o>BOJ)5RVȿ뿷*;rCEKEQLꘪTDˢȚڠ)jW[1=fL~Tks=o 3Vo ?o ;ehcb늽j~;[>~}uk×||?/?48|WߑgoNB=jکv4>Bjq. dq>o)@\@p-Pr_y~9~,*jʇW h.`Ϡp 8to뵿G}8C9O.O m({g{J?+&emw#dwuͼSc9ۨY}ORxeXyϓ} XrWNK}P ʜ 4VJ0'qH '&:a\_F6-RRjqGAiP&e)ǕSJҡt*]5L9P5f#,u:QfjZVKyBBR5*VW7 jڤRCQU=QϩjڣiZ䋨f-ZOju;:u1ԍ]ݡTAfxzꠁ^VZ YCxS'x^TsT4:ND*~W_SBhyy֗g(I~F*]"S即$+ܭbjHƁ&wؼqonF";q)2/0_8 (gs6\Nȝ65=p=nL!}U'c؉:$ gT"$b 7O; w:>pΫw\sog? ^_} ŵw=zvW3 ŠdA\qEX!+"/A """A‡\A$h$ "!CHA."A$J[ !|utOcM2gtΩשSURd@Z\e7[gTS<0SM ٖ0>s9ȼ|l~b׵a;γo{wv/}knk+HH.R#9rt&@B*s~i,h)2DF*:a{:Ƃ"۞e!Zt0}%}%ehE5ft 3SOf#zj0:,s}@0:0 L)0<|F>,0+<|5:÷삾Ex!( N{8)vY[M v㹺R: ⴀ^Cp= > Y30<|%M0[=Aܝu3~ s{>O3^bF-ŒFv#ƛ-a)Hhgt9ZN3O hXv}^;p9lWNskz9#𸢋b VvdV]y4Oxل̴Pq5kdt3ӊLƏxT[FD^_['׌$7dlE>B85~w\E-"aѼZMHܔ@#o4o_Z݌?";0vXe\sTv*@k*d g)J3!8ՎG-acZc0 tn̑ǬaGKuk^ekM8ܑǬ9Ǭ<@9EW7r"&lsN)w}!7`ZI0ifGiVCcMr77#c;}tkqstotՐk!iw>cdR|tջs]f`dkYE #1:Ȗ9L7x&FA#`3Zd :I => CWaO)},aVP#$(퓀qR0Iҭ>T>2][1vSXɰZ&?L+1pf9~zS{`V >F~ F1LYtnF ,VibvǑ&S^C^K,UJ:WkgNG[~#-eJ6_Nɡuf\\ce; |t?vgVQm_JgvocZ/1ǘKDf-Kf[4xivU1#sO$d_63 37 |ry=1 01RF{NAm7co&{e x͎L#yBpϿ ͎f"ƌV-0av:P&o$WUtgD t"3/ݓvZ0h ubcy}|ɀvϖaC OسW8F>cz˳^~,c:"?z{tQ=F=1FX<;&|̾ٺ'8.0_0X/ac4f fp9! e9TG@at{u=9m4 YH-Wˍd#6& Pz*TFوsZ3OAޡ%Ph}l\#-zFwޥz^z;٪P!-zz0~HsU;w^'HƇ0|^*T„n vȽzKM TKS4އ3T-Dh4PX~,`|P#DwI x&B;!RPm(ότto] >ܜ2dV<33N 2BnOF;alG6&3^ ČD -N eH2%Qxf[]̄4/)N8I9UĈbњZ̻̎z[Vcw(iqr}PУd`"}q! i6(}JSKZ'A ط/g{)c:s )c5#|O8|?HQe$f*/2NqQӢ[;mXNi> 94 ]x@}Lgr`q؅@8fX㐱݅@V30R\c* !+sݘmL4& `|OC;`:|1hN`|6`d|2ZF8P tbIѝlsX'Amv>B8|v@s\QH9F=qӐ3r=!ƪR>t98|nq0&sq:,DžRgJh[N;~+X(w>jtj 9Hm/z22B3<8cWØ=zqS.1' ZU (ҧ z Cֿ㯖{m~$oR>VTgQ֦4gWu83b5)s5Fw]}s$kpSRlm>; Ԯ1΄aàZI@*L0DwݓLt1 3ĭ(aVvCDWL`l/(8/#Smz'Ɩ :^M0-t*B"Ыal :^蹰K[.=!@ρ}mSi Hal3v'z*Xؖ@O=gu]V/xe"음MQxe'e~R!P{%t*˃"yRK%t*Iw[V}ܪ&3[JYBНaj8?Pc%t*Ay09r)gUh[ - vr읪34L}9X9r05*[Bu!ڂ1GN;euѵa%Si0lmtLiA操{=c [ȅtubYd}F9UNtE=K՗q l5_tD61FY72})⤐3h=xKcp.]4pķiB]JjӊM5ޙt?e3ZAZAu:}!o0ωմoћA+6g9Z :ӇfՈVfԭ?|H~zZzj_B+4#?1"tBS6HWF>8(ɳ!hAZ8t7)Li5ICi\9$b/Tb2*+Gͣ50AcglJE.]{.J+0;ehi廄gg=}U 3W5xG`- \*%W&7JD.Ty\rv< g+W9m` d#u%Ǵz%{C.lĔX̲jW\%5\R,Z.b.s Y갣yRn'<>\6~Io:,R:=R:Iڍ_(ӾTO2eGoOɃ!6׹ :-Z3X GiC{|#t<L |;vҹ#5lsiɿg5oҼv #dgiՄMwRhbh/T"u1Kp9h44vGȕ/~Y alf0sMfG-yY`m>hҩ;H1s5zj=d=l Ew_u+y~)#uPv5%tWu=LCa2@yhͽrbFi_\ϙ33s 6 ^l2$apwO??~jh5ZWYͭVҺje}jX_ZOZLyMku֊ow  ;+'7?<(@8ё@$3,R+R;R'R7R/bF}/#)~%|~v5Si%ƈ243 aaB2=,ׂY k^@s:#y|,8* \|9(8s 4=-l$&`n:X7Y[Xymk5 ZSÐ3ktPP2Z5£ /S…lMH00(rEqiȵ""7GF#GE+7/?2 2(`cQQ#E`M1^~DمG͡<" F.JmQ9aa۱hF}zQٯNѝ:ճWˣx>Zڄ V 0!B K/,!,h%S|ZܽWh]Nf %):FJKJu*Օڈ•|7+]eB77a#^DGO7>2QīnܘL̑}7iu/Nôw??j|. /} aET_C(U땡&°wFk>`*U@ h)8fc^^J?':Rץ&\;*.Q~(úȃ?73)%[)/ǣ(öJ]._Fiy[EKU|.84VW@h=,_I,F3DG%Ik! Z,.tݡ6W;l[;zR.d$υ. :d͐F^"26Q/#_ke| m&:M-rpm7#\;g1f &qQQu=Ȯcٽr^(\hxpoTh法cspE-} TJxUmjCFPJhCD[[?r̜1d So[+\f%/I~DI΢ \h鷠 >B{ 7%Xͽto,˺hт~nJjekSQq*qEW/'!o+O=VMryFA&<*+H cix\A.T"e!ȤB$HYZ$n(_޼E2Jr>+VתzNrWe6Wڦ 珃_Z+V%q?v,WVEcVEq֞~S ccMd0\]Z<>JU4gT0zWttfEBEq\ E6_ܷ6~d-b = WsUN!&UҜK'#~rhxE񷢸2Tq~+K.cB[we9Q\${U܎+QHJsY|xIYyGa~qiiyv} >ojvԾBe_i7fv3Ǿn-׉v;}A|h,Cvxؾ&e“xکE!'~SaeG{G}0PtXёQǣcOD޴rJ;wfqQQYe$F-VpOu[InuG:WY9ܾі_sUCbUc<JH~n3Q l-0[`nm-{p -s -nC8[pn#8[Sp @{ ,̅YOY_*=fm w&x$5Q& v_|W;^l9YNYr.`\"m* 7mȝp~ޏ!~Cܠj+Sr}]5OVU+mU{Iuݢ-m1)05׆@x5QM43ClB.U+>Z:l_Gj[,v ">Owt\N#V1[~jʩRYv(E^6*wMg,8\V(~(#= M69Q/m+vIїΈ{+Na~:DŽ[,/b<`md]Øl.?t l Z(Stҙlob(ǝD<{BR o4毟ks)/OQ ! "W-eLv<؛xK*F|v5F>j׀'H1Vb 3AL90]̄#}1̃bXmB/!>Èy N:%WO'}N݁mj-z B ^/.sYr Elc9dNg3Ldw`p"b=/XJN]7Eg!-:&hH} ay?'u=@P^D. Tc`&ʗ(aeRO=+p]NKd+qIYS•gez\3Aԕ|_E)Yβo"d '⊸,^%'rXN)NQWQYp}; q^ jejH)t-%~jһH懔RiGO0'=zFF׊fno3BN^!P?L>xM#'%F^Sv\MUKQ_ϕC]Dqڃ8ΎS4qDxi'zp5CqTlmOKRrS6G)In S$?|[')K(9eӔܢ,IYR1|\q,Wc5e ,5LcouX>g)k|)뱱Kq&9.{lNJ~<>)k|)x32vc)x(ΙU*ySrb R7Qq[{2^r٥9Ht'ˆK|HCZVJ\:KY~ź99쯀2nx_-З3seܟJJ_yt5NCsi4wZ8Nuwnt:8N-έNW'twptz:w9N/s3<?kzX@wҿ.߆ϓe?qT;!!cb_PGc~{;m[MW'?ARt?Ҧ/]{ }w r+]iXwH?,l([!Gi]i>ytѫq}R._6RY__l4ۣ焾V~].>I{cRcOm6&dYuoUF:a#wg ..uac:RI/V4lJfy h>RގK6T;.E9w]LFvLVUi.x];v؈KWmW`s}_3޹_SI,y3 b'_@ms,ϕ{y _PZa1—Y^"/!.Ry)qˈ\^N RM^)$*y.Wy )גZrEjuS^/'^rM RG(o$zyțW"o"uV'oyԓw;HSI].R_-& =WK}_OX>($MT>$"a\>"!-Q77| w+6 i+ONɧrG˧WH'*$YXrsOGʅdLSdL7dL(2dL2 YUƇc{xd1Br20q9d21I$+d5F,O0UA=jdFTcCH2FFƔre<S$/Wo\77d;YRYRY,,@B!?j"?j#?<^Ȍ od2&0c' ' /P50,8ᇜpCNx 'j"'ȉzȆdC}|N>,$_^ ׁA//"477'M +o"v;3؇} D#3#3*#'F8D!b8XaF."ъ[qBt8qS4 Ng'q{)>N?bx*{SK{Z oiah },q$. obYƭ6Xwpg U=Pޣ[^yޓ ߎC^|~'d>OS|?_̯MJPm/OgAv#Xv J'4 XuG ]0B0X5+TF )B0&ZFͥCZ1-m3%*ae~&a2ĀBd_ i O!@N /B_)AӉ&3no"boAhŐLy0`y(^B)#SLʵG6Dcxb#Pr,涅a1[EEQ~1x?CF g bt,0}kb5L9 﨔y0~ˌ-BlilJ,0<~i8b;A csʵ;cG0Mk _\DKLP"ʱ͹ˈX EDVП0ljr -J!~iFba+qJpV)bIǹ5QwSџo?*[0+*<+} `SRk2uԓ@D[vCCi(E3tb7`,t49HQJ2yC4ј<rgyY{`w^j#D5³ؾQyd!ma;F JGcizc8zspq8W'.^Y&ވ3\L<'lp4FDVFU>% wg;&ijbC/|'iڑ/HDqtM4<).koQ~ ^7]>8Δ4dΙu3N ex9K(uaeLa<_+|n&WgXgUIʙ0O@a|O"_ޯ/m$%' c#x5 3Ra?\0|I일SXSzb(6va G[<3)*GPU C%?z WxbceZ hJʬ Jԋ2›+o lxb+\J\ h59|<> q}ˮ`Ja^b0_灞'xe~+c>\ >ư\N!nBy+)H+Ko`!͕G##x+[Ayʄǣ5(2Ӫ<{_.z /0'x4`aeY 3=7q=ן-w*DP TE#({PUD[hĊBLَ-V:H=ة''IzWWgJ*©>>={J}C1טhL^cOl4=5=IMMҌԌ$j{F3A3h5(ff%qԬլܦF,44hI Xi>Rm7⌜1FCij6Oinio>>$& lvݶ;໶\gp\\bcWݮ::u bd7n>1[jpnvЪ6iqI,Ix"Cl IIyA:#!tV: i~~$69 \.tUJmHu`uu!v]1ӅBtaZK׋T&Z]_]_⤋EUQ(H@ʡrnN ۩D pT_lߍl9VE-+TUҾdk_ܦY n#wg-)KB-\Q<$޻xwX21~~%C!1K '=B"IR1#qtFBg3%\gNx΂tVDNԩg:5iuZ숨t$N:'ѹ\]FP`dB,ebFg?:WŞKdcJOh]hYhWhS@"BsnpҾfZOj־Vئc9 ֟XoXaM^:o8Y"cYJQ-R-E=U>ߨcԱl~N6vuf*¬$7ZzW>dsFl`mk4CCO>=ʨ "Ҳ4~rE_I1JBD1|L7ҤÂZеғ'Dciw&Ƙ LQeVeOCfyWd-ͷyY^$``(s'gxbUU AeOg!! )!%g f$ _YQ*JJbN0JY&SJO# Wpv@'*8XYjQ?pW22y7|Br;}Ui@FivI02,Hs(5i%VRKm>;NLB$WɕJ5%/TG!#H@z z4&R39ZJHVNq>XRVD%ߥAO>%n8"vùa$~ \/ƾY6?O 8ҧ8~jlV+MC+je8Q2Gب5FDؼ18)2;=+HVMvG9 I'ҟ #qd pCR!3A`婐 Ov|kC?LS}~e&QSwLJGQ XzR#(H,&M0VsݺUS; LLh6SU$jm q&:7KKWX'?пnX~l)ނ[TWS>Vm?("Eז-vl7Ыn@@W`Ӏz>nJ*Q׈Q")Եb S#§Prs.R~z?ÛNP-܏`uMV{j;^9u!?͘7mtǕGoY [V|;|ǿ*iulaNz(AI[Asr߬4v<٘!Ioq{}V淛<4v>l}K$tпo:ejA 0;ԉb: q$S֍ސDfl iddB^NߦKmhȑ#+AD rNԫYy z,yg,I~#gK<;L\=|g }˅Wh`eSly9v,nㇽŏ?ѧS0c7*7&>=6F [ؘ7b,j=w5*2reW,@㫇Ofo|x_j&mqg2mv(34xA=Ӧ"+ݭޟs͛mH.jT=,6/$wv=Ql͞c&ߖUjEWM5fnFLS H^q$roܜm+7Sg軰*آŭ-i죑o]Ƿ@_~^~y [+ ^@4*nzV*/A|-jJKNOSg>wuZ9GE8c]sZ$ҳ{~֧J`F-fJ>pnq67rKj=c}v|C /mں篵&ϟZ7gRw׸Ls_2v:N .y'L[kN;%qa?5Rߏfvuדj;çg3-NY#57w;ڿ؍!r3[N9[wbKF}JmUϬfOfԣwR\f|RǹsL6u Ao-:5S|PwchN}qu}7>m>2!a/?'~(&[}xtU.w5cNPq}on)b1aysk}qdc]vc戜uͰNnu ɃiMceڸAt> rۥu~6Q~->q刔;x-hNͦ{L3ly`NoYY^n7ŁF /1¹Aq Qqu}|qu?C̾_0dL~K?[c礎6-Ds[&B>Ӷal^z${;'<2N{Zk-'-5;{fK|yƏfRwUu{>p~1y(W}tsט.ZoCڵXźf]>a1Gs%W􇡭Y[;wc?չ]8gz屝M}RpJL-pG::??7ɥw pёږT8x[iF9S\U{闯M|*yu7>I{[=4]8h϶,?'@g{5͘O>j'X܌oT2\}~ybwh׭X4{dmIzR;suYMƯ UG;^?cȪO>k4; gme+ؐbtwY_&Μ9\~p:Lc3{N+θ.yv:4텇4"n9Q9Wco.u̧ft_pIyFR/*ҧ֧/ sq(M{#WW(d@_}eШ}?>cI~?vpl`[yILMa.׊#x@Yh}UDTs㬜ƧىV'}ym;]כ{[kF==ᾲэ#vPչ4=ߛr#1Z`KWņ'-`uɧ^\w}Sl~% 聐vϸo:OlYMƞ-RG>`8vF73nܴ~Eݥ :_&*K5r/zgJ%ΨkXΰ2;_q:+$g=H5]Б*.VE_U~\V=koݼWJs˅/=Hpq}rpQՃ* 9 QLdJ (a< KOA[G,SB*.(IW=MaNj/UL8cp_prLNMmPzgR%)o6NA6~lǮ9+[e˧X>zrŶJp %ͽ_N1iؽd%+2.вʎL̋1Iݴ}꺧^oL3|l?qt^?l$QsxZr:tlnt0*TE=+";3o/9ʶQKî^7f߯eEk]=uJ]|86(l>$póK_x8}N[9E"~sLe}|꿙ma̴ <}) G7^jZ.gzҢE󫪔~yL_]{OB+mV(}ן 21xw~inDۋs7+-4Rzȵ3Kb.^zh쿕:T,[pְeA&FFƩ]qaDL,h<*|ِy ېYV@XⲼkB5NhZA 0Z  Ubɛ4`vR`f4PK'Y TpʂĂJ!ؽoYyQl wod7䓭ZW܄\rpJ(ۭ/f,Y*I9&x>r?a{[NwY`}~JF=lyۿGn==7e%9Ktl޻ V\n}Q\؋B̜66k<(9V).Lo$W]e#ОeFwEL]T)3V~{-ėxjOZ^j!7u61i'*8b3lb f߀uıϴ!X $ɍ1dZa5@Ft~b=/@kѼ+2dgoD2Ҋp=Sg8L\^Rc?z])_ ytjjf^2KYy:WJϹi'zy6zNqQ'7{:ʺ R5Xӎo:6ʻ{e޻oӿɑw=47ȥ©|psKvp7d ~cN؅[^N׻gwkvfYs:^|ś_ܺS+qIJ-x4>:gSW4?.2:ZN endstream endobj 123 0 obj [ 710 0 0 0 573 0 723 0 314 0 0 517 930 756 800 625 0 655 537 595] endobj 124 0 obj <> stream x |ՙ;\IHH$dIHBH)FD!3$DL:3!@Eڿ[/k؎ШQ6`h?RVCf;Iڮ$=sΙKPhBD./|x~ %5^~Ѕ_Q:GK.bᕅB^JK/ZCkrN: a:WٯG_o]"W7|-b"c74n]Yx v՟[,6RND&s-F֥5æj~|1}`?Oq2i(ŢDƉL)K>튿HOEp'F}v L@,eF D`KXih Co<_@8\o5ڂF Xr,ZaHXjjd*j YQ[1j("٣f^p5Njt-KeTLs֦D~m17€ ʀ5P\HqMgJ⺀xsQAGllƨE/aCxƀ9ZX#9u\.[(Jy*SBCG(?%u!:sy ӌ@=2fY |yݐ-1ƾ(UļÚ1UA !t'#6S~A AeSdsxihD" ]_ewͰWyweX hEX>QԛC}!;X^G#&KT0ut,/4ã5-9 qK j hB@ʘVP+Ҵ|=lͣfݢ=jα.\'#+qlr)*Jg=`tos+S\KثЎ*J% !Qv<8%gV r,N"̕MgI%Ika}V&@}!mU%Rd9EYoaFZS!C&d<[6OTj댈0˰kLV&) s>a U$ϜG$u`uԋ{o4Lɇ}Op<"1xnvG 1}qw l|o\Uk`4'H7xIp< Gݒ?/Ф2yIaNϨ52(fJfKs3솽ރN.U+ldG iP@|4ESSC#!-PRh&Mff2k%B4KLfaD<6FZe@-f刈=*풀Q _י(:((>BLXdDDpʒ1i%MIqx>9gezi=3dϜ8+99񇵋8?IvqBSb4^gYت 0lN$A‡tIuǥ|KONVyQ_py˰%$"sNO;n\I)c.t_uui^|MeHĘ!bc⩉YlOK,`bd!<تjU{,*Sq=3g1T֎ʳK?1uNM*&7("TǍYh?ׄE8$ wBҡST;]Y1X,kY-æ<-8-_2 s69N ƒS3ogd vB\\({6ycso]_=mښ 湙)bD,1Q6ۘMOv^f404-2-Xn5lӆg*Ԇ vHb1Ký-d ~ -/xN lUoK!k\Q^ZܜIi⣣lQE=A(b40OV ϖu*fY4s¤|53?@EM6L)iKƚ!!.)+O $ZƙY9饉eYJ,c#lf&'M4~c/oo L5j)?׮3n^y{ᦇ-gL"&$~X1{6aնcr~%!4N0*lr1jR)a2rERoaڊHy0+oiq*ng)ZE}E Va6MJ-VcMJ05˦tVkl7,JUiw*QJaJSʐOa}\͡3BILb #=+^S+{:>sd6vV3 e\$X.hIF.c5 ڡȄi6\_gE-7Lk*ݜiZyIί0E&ƟiV麊qcSbc2"s\R`2Ś!AUcUl $Fow# 4eܥO8nLb鿱 f_0G%ĝi`amRY}~=hkX/ƈɢ":+S6%w*h24-aR(e&-LSўM*y]̡JdY.JݔDki)J晬x{~5<{u7?x5**^s̓~xoxKojYUsGUՎN:k=0'?UBmYud1MdAEs 3AU2ct h?xUBl?idP+o&`GWJ"tuMkט II%73?}gV~-wiSފIcϺt%kiN/~L宔I9Ҋ*s-*ɟڵei%U_3dJK3sg[U5K}y $"GnWd5fuwYT5:*}rܟ[dYfٞM *rJȘnzo? mk~"MіWI㧤N2&!*BƩ.]YMMY&1y$"a#mE=(n挫gN([QP5+olծk|YyiJL˻bGKCgXhI)xUW*ot\t9BGF4&y0)Wa~$Nr!ϔ ᰎBIVùt6;XLyj {p na/ćf9̐,~C=e{YJiR&irzhϴE$ZDk|ޫKtsRB|is,_h?w _Af_WN{/50~7=n{Pa[^V[[ۖTodчa785U89wY\/s-Q%rǥ>\KԵ<$ p kyOD ^Ei\r0 ĵD]˃'D9M\YN. r"T{NԚ?S0W OsQ6F"e5(ۨ(G"q)YrǪF978W }F9VXFyxLHm -r(k"Q6ȘsF,V|([Db+F*jbeH6y)bgDm}|pQ4*(NJFy3Qqѕކ znKnZit5խ\mm m uz[s{7*O__jr.'Pns7hjmw{uF~jws_wSC#Q=Y fvFLaCt^mZ^$W~:XzZ}n0JX | =}ҡtCP\iֹ9l(gzw˻I[Q=w2kԶ6hQ Zgȗ\y^ŕGP-.Ni.BoV7`[{q2EQgD&mڬXbʋMơhPswVV[ídli#61^M.a6}jjkmne}C32:\2VЦgØ=Ȩ j Eo=5!MUV芻FmM(7Z;LPo`BcxkTy뽾]!]J7R83CR Ji#X_zjU *K‘"*C(VžiV#dv{W.{Uu} ըzUw(bZJG٧Y_^* C;G(#:<[lτֈzKa¿ޞdkz!$U^b">M'ZcdE>jD#wZ2[2GpȿyWףDD0kxM~˅iQU*7߰0ޑ3ʌTIm`R6Dפ M Jט[KvkQ%Qg~#؍G}9hգSF?x(Io1~;?O+Lۓv6ݑ-gBꄍ>qΤ~7f$f.|;3+/ۙ}0w97&ܑ3ٱ`aS.ZZ%J~>-sZM?XVS7g)yF֌kgY2ƙ*fpߙS39s_|I*ZxmE%cZڥGm[C[s+v_ .|1:Z$pO|Y]$K*3Y`/ U]`%X6ѷ yBy+vp2w` { npp?x<ȜCxGc(8OgYu#9_')*~ oP~ ~> kY0tv9;g`&`&`&;ug ֝3XwΠ}}}}}}C>>}#~H~,Vj(v끭ꁭj1 9Z1rmpX|B\}}xhV۹sp+ w!;yt|W2΁۱b;Vl<+VN,Y%vbw܈}b6| :KXr#Fh*ډ_;k'~įv;)~ؗ ƝSoGhfǭJDaS4Q >8kn9ZLA&Oj<'DAKO` rm\E˂gfQJ.羊ܯ ?k(W!x―aFX9y٦EcR%۩o|z;.\nn  80xp Imڞ86= Agif縿NNR"/i8?bkyW ʿ-6x3PT$e-=H% ?1̳Ԝ`">O ;A#c`;;N ׃=.> Ɲd׹ A,W4FI,@P*m FľY;x9ڮ&v#nd̜DL'1I̜D{^D+Jݗo [mvp: o,[ÏΐKZtN,] rV.'tb-6b] q.[A;x~oO禣aZUU5Z5JtJtJLT2+Y X X XYYXYXn-в -в -в -.," .,& .," .,& nl"Ⱥ.&㺰˪Iƪz^Ī,A4A4A4A E$x.d+9 RP< 4+ x8 Y#Ljq8|X9N'ZgֳDY,zh= ?4s~Ni9 74ܜD1"|NNi",|&&ljqb8g0)t4"{&vۉ ?PL~;ќbs D}j@m,` XoB,  `b[ SN[6p;Ŝ" xx Itxt39_'){9_`s:_7(>\n?"$R (_mZ,+*p;N ׃=n~xCxGc(8Og,㞣γ=m~SȏȏԷ1w1J6 Z7Qn7p+ _ߝ`$p/ZNf=`Q0ϖ~,˃>;YxىKշB Ydj5FVsJۃj+;jCnnt  :Cap<ʼG?cq$6mONp|ݞr?x^'h'{痰4Wo?=dDY<_bxcWj^mǫ3,}x^&߻Sx{'D^p><0<Ї:@xtX`y,}r/,r/,r/,p/ p/ p/ dL^X셹^}`o[j>ꃭ>9E~XN dY@-:Zb`9NfX,g :_- z` Np5du;Y#NVdu;JFΝCw[D?P-jmJ(ounp=>]s`̝S0w N)針~針~針~釙~釙~釙~x&^S0X~ M,˻ >;0K`,=}ѺfcM|~)HۏNvI/| ?cfqgHޏ!gHޏHޏHWXXXq'S+R+R=+R=+Q=+Q[AV; 2IV|\&d@7 ߻[tDw7MtwD|/&n&l~CǬH"Z-[ggggggg-D 782rb%`)X Vv]`7~<ap<cq$x1qz <6OPObg'ot0GTy'[E"T,J1J.ceVaeVaeVae2{"cΆΑ?\G,tK?9~־i3刖#Z~˿3ِ0OG}?ՈGaDF'sп'[~ދxW?^4e"ُd?RsW y>D?ބ7!ُ[t z߄[ɏ7<3>oMs~fcMw݄&On1>}}?dk7Yȿ2/p9:ĈG2f$c>;f͈v#mV'UѴ;ԿX|Gx-b_"A$ ;|SP4Q* 00hMEbX*K Q#.+ Q+֊bԿUV^o:CnqA,[ĭ6qC|])o!qOA8$#1qT'wDxZ<#oG$^gī5^Ck7 >1|u =ő & ?2C@⃮7be`Ϡ&ur2EqiA1tA9+l'd pJ@ӋoT(((( w % H0I \ uF`:3d121fp>G n_' ?) endstream endobj 125 0 obj <<882C8069C5BD9D45BFEBCB22DD6469A2>] /Filter/FlateDecode/Length 322>> stream x5һ/C{oի^gճW[Գ}Q϶tD"fLTX;Hج$Aj|9$ ')^w@FВYm n xGH_p.d}z&8RC\S!#IJB<-$vM.pn_W\JVa 2I `(B(b( TBA9TXjlPuP MFCB 4C'tڡ]~^|0 #00 c~4L$!300,,Babz4$RB.&|h|o-Rh`]Q~*C endstream endobj xref 0 126 0000000032 65535 f 0000000017 00000 n 0000000125 00000 n 0000000181 00000 n 0000000593 00000 n 0000003018 00000 n 0000026982 00000 n 0000032530 00000 n 0000032702 00000 n 0000032945 00000 n 0000033120 00000 n 0000033365 00000 n 0000033503 00000 n 0000033533 00000 n 0000033699 00000 n 0000033773 00000 n 0000034018 00000 n 0000055090 00000 n 0000065927 00000 n 0000072576 00000 n 0000077035 00000 n 0000077205 00000 n 0000077446 00000 n 0000083307 00000 n 0000085207 00000 n 0000085379 00000 n 0000085621 00000 n 0000091371 00000 n 0000095896 00000 n 0000101619 00000 n 0000107577 00000 n 0000111577 00000 n 0000000033 65535 f 0000000034 65535 f 0000000035 65535 f 0000000036 65535 f 0000000037 65535 f 0000000038 65535 f 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000000 65535 f 0000113393 00000 n 0000113783 00000 n 0000127820 00000 n 0000128211 00000 n 0000147008 00000 n 0000147395 00000 n 0000147938 00000 n 0000147974 00000 n 0000328385 00000 n 0000328473 00000 n 0000338968 00000 n trailer <<882C8069C5BD9D45BFEBCB22DD6469A2>] >> startxref 339493 %%EOF xref 0 0 trailer <<882C8069C5BD9D45BFEBCB22DD6469A2>] /Prev 339493/XRefStm 338968>> startxref 342173 %%EOF